Busch Lab

ZMP

med24

Ensembl ID:
ENSDARG00000032459
ZFIN ID:
ZDB-GENE-030131-2341
Description:
Mediator of RNA polymerase II transcription subunit 24 [Source:UniProtKB/Swiss-Prot;Acc:Q2PW47]
Human Orthologue:
MED24
Human Description:
mediator complex subunit 24 [Source:HGNC Symbol;Acc:22963]
Mouse Orthologue:
Med24
Mouse Description:
mediator complex subunit 24 Gene [Source:MGI Symbol;Acc:MGI:1344385]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27889 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3811
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106375 Nonsense 215 988 6 26
Genomic Location (Zv9):
Chromosome 12 (position 8850718)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10632451
GRCz11 12 10670754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCTCAGTGCTGTGAMCAATCCAACTCTGAAGGAAAGTCTTGAGGAGTG[T/A]GTTTCATTGGTCAAAAGGTGAGAACCCCAAAAAACTTCAGACCCACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27889
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106375 Essential Splice Site 421 988 12 26
Genomic Location (Zv9):
Chromosome 12 (position 8845982)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10627716
GRCz11 12 10666019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGCCTCATCTTGAGAGCCGAACCAACTGTCACCAACATCCTTAAGG[T/C]CTTCGCTTGGTTTTATATTAATTTAAAACACATTTTAGTCACATGGAAGC
Associated Phenotype:
Not determined