Busch Lab

ZMP

zgc:63474

Ensembl ID:
ENSDARG00000032435
ZFIN ID:
ZDB-GENE-040426-1129
Description:
Zgc:63474 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYE6]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35591 Nonsense Mutation detected in F1 DNA Not yet available
sa8743 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35591
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045475 Nonsense 132 210 3 6
Genomic Location (Zv9):
Chromosome 13 (position 49012107)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47748879
GRCz11 13 48040119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACGTGTCAAGGCGACAGGAACGACGAGTGGATGGGGGTCAGTCTGGCT[C/T]GACAGAATAAACCCAACGGCAAAATTTTGGTATGATCCATTTAAACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8743
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045475 Essential Splice Site 183 210 5 6
Genomic Location (Zv9):
Chromosome 13 (position 48987951)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47724723
GRCz11 13 48015963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTYNNCCTTTCTCTTTCTCTTYCTCTCTCTCCCCCTACTCACTCTCGC[A/T]GACCATAAGAAGACCTMTGGGGAAGAACATGGCTCGTGCCAAGCCGGGAT
Associated Phenotype:
Not determined