Busch Lab

ZMP

rnf145

Ensembl ID:
ENSDARG00000032373
ZFIN ID:
ZDB-GENE-030131-5264
Description:
RING finger protein 145 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWF4]
Human Orthologue:
RNF145
Human Description:
ring finger protein 145 [Source:HGNC Symbol;Acc:20853]
Mouse Orthologue:
Rnf145
Mouse Description:
ring finger protein 145 Gene [Source:MGI Symbol;Acc:MGI:1921565]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23987 Nonsense Available for shipment Available now
sa32353 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23987
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047515 None None 685 1 11
ENSDART00000138575 Nonsense 5 77 1 2
Genomic Location (Zv9):
Chromosome 21 (position 32998341)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33998034
GRCz11 21 34032524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATAAACGGATAACGCGGAGAAGTTGGACCTAAAGATGATTTATATTTA[T/A]CCAGAAGCGCACACAAAGACGAAATCTAACAGCGTGAAGTGACTGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32353
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047515 Nonsense 386 685 9 11
ENSDART00000138575 None None 77 None 2
Genomic Location (Zv9):
Chromosome 21 (position 32982869)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33982562
GRCz11 21 34017052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTCTTGCAGGAGTTTGTGGAAGCACTTCCGAGCAGTTAGTCTTTG[T/A]CTTTTCTTACTGGTCTTCCCTGCTTACATGGCTTACATGATTTGCCAGTT
Associated Phenotype:
Not determined