Busch Lab

ZMP

mest

Ensembl ID:
ENSDARG00000032319
ZFIN ID:
ZDB-GENE-991111-5
Description:
mesoderm specific transcript [Source:RefSeq peptide;Acc:NP_571118]
Human Orthologue:
MEST
Human Description:
mesoderm specific transcript homolog (mouse) [Source:HGNC Symbol;Acc:7028]
Mouse Orthologue:
Mest
Mouse Description:
mesoderm specific transcript Gene [Source:MGI Symbol;Acc:MGI:96968]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40263 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26266
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041070 Nonsense 158 344 5 12
ENSDART00000125389 Nonsense 157 343 5 12
Genomic Location (Zv9):
Chromosome 4 (position 15065475)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16001328
GRCz11 4 16000083
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCATTTGGGTTTGTCAGAGCAGAGGATCAACATCCTATCACACGACTAC[G/T]GAGACACTGTTGCTCTCGAGTTACTGTACAGGTGAGGATCCTTCAGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40263
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041070 Essential Splice Site 187 344 6 12
ENSDART00000125389 Essential Splice Site 186 343 6 12
Genomic Location (Zv9):
Chromosome 4 (position 15065293)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16001146
GRCz11 4 15999901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGAAGCGGACACATCATTGTAAACAGCCTCTGCCTATCAAATGGAG[G/T]TATGTTTTCATTTAAGGCTTATTTCTTTGACATCGGAATAAAATGCATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1856
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041070 Essential Splice Site 259 344 9 12
ENSDART00000125389 Essential Splice Site 258 343 9 12
Genomic Location (Zv9):
Chromosome 4 (position 15063607)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15999460
GRCz11 4 15998215
KASP Assay ID:
554-1847.1 (used for ordering genotyping assays)
KASP Sequence:
ACATGTGGACAGGCATTCGCTTTAATGATGGAAATCTTGTAATGGACAGG[T/A]GAGCAAATGTCTCCATTGTATCTGCAGTGCTAATCATAACCATTGCCAAC
Associated Phenotype:
Not determined