Busch Lab

ZMP

tox

Ensembl ID:
ENSDARG00000032317
ZFIN ID:
ZDB-GENE-070912-181
Description:
Novel protein similar to thymocyte selection-associated high mobility group box (TOX) [Source:UniPro
Human Orthologue:
TOX
Human Description:
thymocyte selection-associated high mobility group box [Source:HGNC Symbol;Acc:18988]
Mouse Orthologue:
Tox
Mouse Description:
thymocyte selection-associated high mobility group box Gene [Source:MGI Symbol;Acc:MGI:2181659]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15155 Nonsense Available for shipment Available now
sa38325 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15155
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Nonsense 71 539 3 10
ENSDART00000132039 Nonsense 49 225 2 4
ENSDART00000134912 Nonsense 71 203 3 5
Genomic Location (Zv9):
Chromosome 2 (position 21839512)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22384927
GRCz11 2 22042989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTAGTTCCGYGTTCCTGCGAGTCCCAGCCAGACGCAGCACAGCAACAAA[C/T]AGGCCGGCGGACACTGGAAAAGAGAGACCCAGACACACACGGATGGCCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Nonsense 160 539 4 10
ENSDART00000132039 Nonsense 138 225 3 4
ENSDART00000134912 Nonsense 161 203 4 5
Genomic Location (Zv9):
Chromosome 2 (position 21854791)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22400206
GRCz11 2 22058268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCACCTGCAAGGAATGGACCTGCCCGGCATGTTGAGTCCTAATATGT[T/A]GAGCCAAGATGGCAGCCTGCTCACCAACTCTCTCTCAGTGGTGAGTACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5130
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Essential Splice Site 258 539 5 10
ENSDART00000132039 None None 225 None 4
ENSDART00000134912 None None 203 None 5
Genomic Location (Zv9):
Chromosome 2 (position 21867764)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22413179
GRCz11 2 22071241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCGCCCTCCAGCTCCGTGCATGAGGACGATGCCGATGATGCTGCCAAGG[T/C]GAGCCAGTCTTACCCATTCTCTGATCTCAKGAATATAAAAGCTTATCTTC
Associated Phenotype:
Not determined