Busch Lab

ZMP

si:dkey-19f21.3

Ensembl ID:
ENSDARG00000032238
ZFIN ID:
ZDB-GENE-040724-76
Description:
dynamin-3 [Source:RefSeq peptide;Acc:NP_001121996]
Human Orthologue:
DNM3
Human Description:
dynamin 3 [Source:HGNC Symbol;Acc:29125]
Mouse Orthologue:
Dnm3
Mouse Description:
dynamin 3 Gene [Source:MGI Symbol;Acc:MGI:1341299]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23656 Essential Splice Site Available for shipment Available now
sa32280 Nonsense Available for shipment Available now
sa13688 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Essential Splice Site 129 825 4 20
ENSDART00000141290 None None 229 None 5
Genomic Location (Zv9):
Chromosome 20 (position 14816033)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15005279
GRCz11 20 14901259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAATATCTTCTCACATTTCTCTTTCTTTATTTCTCTTTTTCAATCTTCA[G/A]TGTTGAACCTGACTCTGATAGATCTTCCAGGCATAACTAAAGTGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32280
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Nonsense 548 825 14 20
ENSDART00000141290 None None 229 None 5
Genomic Location (Zv9):
Chromosome 20 (position 14792638)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14981884
GRCz11 20 14877864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGATCCAAGGAGTATTGGTTCGTGCTCACCGCAGAGAGCCTATCCT[G/A]GTTTAAAGACGACGAGGCGAGTAACTGCATTTAAGTGTGCTGTTTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Nonsense 645 825 17 20
ENSDART00000141290 Nonsense 114 229 4 5
Genomic Location (Zv9):
Chromosome 20 (position 14758400)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14947646
GRCz11 20 14843626
KASP Assay ID:
2261-4067.1 (used for ordering genotyping assays)
KASP Sequence:
AGATGGAGATGGTTCAAGCCAGAYGGAGAGCTTCTCTATGGACCCTCAGT[T/A]GGAGCGTCAGGTCGAGACCATCCGCAACCTGGTGGACTCCTACATGASCA
Associated Phenotype:
Not determined