Busch Lab

ZMP

srgap2a

Ensembl ID:
ENSDARG00000032161
ZFIN ID:
ZDB-GENE-060915-2
Description:
SLIT-ROBO Rho GTPase activating protein 2a [Source:RefSeq peptide;Acc:NP_001041700]
Human Orthologue:
SRGAP2
Human Description:
SLIT-ROBO Rho GTPase activating protein 2 [Source:HGNC Symbol;Acc:19751]
Mouse Orthologue:
Srgap2
Mouse Description:
SLIT-ROBO Rho GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:109605]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11022 Nonsense Available for shipment Available now
sa19005 Nonsense Mutation detected in F1 DNA Not yet available
sa41819 Nonsense Mutation detected in F1 DNA Not yet available
sa38836 Nonsense Mutation detected in F1 DNA Not yet available
sa17814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11022
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Nonsense 18 1100 1 22
ENSDART00000103865 Nonsense 18 1100 2 23
ENSDART00000045391 Nonsense 18 1100 1 22
ENSDART00000103865 Nonsense 18 1100 2 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22416053)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21422284
GRCz11 11 21582852
KASP Assay ID:
2260-4216.1 (used for ordering genotyping assays)
KASP Sequence:
TGACGTCTCCTGCTAAATTCCGAAAGGACAAGGAAATTATAGCCGAATAT[G/T]AAACGCAAGTTAAAGGTAAGTGAAATGTGTCGCTTTATGTTGCRTTTTYA
Long Flanking Sequence:
GAAGTTTACTGGAAGGAAGTAGTCTTTAGAAATCTGATCCGCTGAACTTTTCTTTGCCCTGTGTGTGCCCAGTGTGATGCTGGGAAATCCTATCCATGCCTTCATCCAGCTCTGAGGAGACTCACTCACACGTCTGACCGCCAGAGGAAAGACTGAAACTTTTGAAGACGCTGCGTCTGGTCGTGGGGATCCAGTGTGAGTGGACGGTGGGATGAAACTCTTCTCTTGCTTCATTCCTCTGCTGTTACGGACATATTACTCTACCTTGGAAGCCATCGGCAGCTCTTAACTAATAATGCGGCGTGATTGATCATCGACAGGAGACAATACCCATCCACTGCTTTCCATTCCCACATATTCGCTGGATATCTGTAGACGAAGTGCGGGCGAAGAGGCTTTTGTTCTGCGGTGTTTCTCGCTGTGACGGGACTTATTGTGTTTAGATCAATATGACGTCTCCTGCTAAATTCCGAAAGGACAAGGAAATTATAGCCGAATAT[G/T]AAACGCAAGTTAAAGGTAAGTGAAATGTGTCGCTTTATGTTGCATTTTCACTCGGTTCACCTTTGTGTTACGTGGTGGCTAGGTTACAGTGTATTTCTATATGAGCACAGCTGGTGCAAACCCTGTCGTATTACTGCAGAAAACGCTATTTATTTGAGTTTGTGAGAAACAATGCTAGCGCTTCTCCACATGTGGCAACGGAATGATAGATGTGCGATCGGTCAGTCAGTCAGTCAGTCAGTCGCCTAAAGCTATATTGTCTGTAGATACACAACTTAAACCGTTTATAACAACGCTTTTACTTTAAAAATGCATTGATGTGTGATTAATGTTACGTTTGTGCTGTGTTGTACTGTTTTCCCTCATTCAGCTTGTGTAGGTTGTACGTATAGACAAGGCAGGGCGTTTTCTTTTGCCCTGCGTGTCTCTATGAGCTGGTGCGGTGCTGTTCAACCTATTGATTTTTTAAAAGTCAGGTTAGCTGACATTGATGTTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19005
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Nonsense 18 1100 1 22
ENSDART00000103865 Nonsense 18 1100 2 23
ENSDART00000045391 Nonsense 18 1100 1 22
ENSDART00000103865 Nonsense 18 1100 2 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22416053)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21422284
GRCz11 11 21582852
KASP Assay ID:
2260-4216.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGTCTCCTGCTAAATTCCGAAAGGACAAGGAAATTATAGCCGAATAT[G/T]AAACGCAAGTTAAAGGTAAGTGAAATGTGTCGCTTTATGTTGCATTTTCA
Long Flanking Sequence:
GAAGTTTACTGGAAGGAAGTAGTCTTTAGAAATCTGATCCGCTGAACTTTTCTTTGCCCTGTGTGTGCCCAGTGTGATGCTGGGAAATCCTATCCATGCCTTCATCCAGCTCTGAGGAGACTCACTCACACGTCTGACCGCCAGAGGAAAGACTGAAACTTTTGAAGACGCTGCGTCTGGTCGTGGGGATCCAGTGTGAGTGGACGGTGGGATGAAACTCTTCTCTTGCTTCATTCCTCTGCTGTTACGGACATATTACTCTACCTTGGAAGCCATCGGCAGCTCTTAACTAATAATGCGGCGTGATTGATCATCGACAGGAGACAATACCCATCCACTGCTTTCCATTCCCACATATTCGCTGGATATCTGTAGACGAAGTGCGGGCGAAGAGGCTTTTGTTCTGCGGTGTTTCTCGCTGTGACGGGACTTATTGTGTTTAGATCAATATGACGTCTCCTGCTAAATTCCGAAAGGACAAGGAAATTATAGCCGAATAT[G/T]AAACGCAAGTTAAAGGTAAGTGAAATGTGTCGCTTTATGTTGCATTTTCACTCGGTTCACCTTTGTGTTACGTGGTGGCTAGGTTACAGTGTATTTCTATATGAGCACAGCTGGTGCAAACCCTGTCGTATTACTGCAGAAAACGCTATTTATTTGAGTTTGTGAGAAACAATGCTAGCGCTTCTCCACATGTGGCAACGGAATGATAGATGTGCGATCGGTCAGTCAGTCAGTCAGTCAGTCGCCTAAAGCTATATTGTCTGTAGATACACAACTTAAACCGTTTATAACAACGCTTTTACTTTAAAAATGCATTGATGTGTGATTAATGTTACGTTTGTGCTGTGTTGTACTGTTTTCCCTCATTCAGCTTGTGTAGGTTGTACGTATAGACAAGGCAGGGCGTTTTCTTTTGCCCTGCGTGTCTCTATGAGCTGGTGCGGTGCTGTTCAACCTATTGATTTTTTAAAAGTCAGGTTAGCTGACATTGATGTTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Nonsense 38 1100 2 22
ENSDART00000103865 Nonsense 38 1100 3 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22330780)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21337011
GRCz11 11 21497579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAGAGATCCGAGCTCAGTTGGTGGAGCAGCTTAAGTGTTTGGACCAG[C/T]AATGTGAGCTCCGTGTGCAGCTCCTGCAAGACCTGCAGGACTTCTTCCGC
Long Flanking Sequence:
CACATATGACCCTTGCTGATTGTATATTTTATGGTTTTTGGAACCATTTAGTAGACATATGTTGTTTCAATATGTTTGGGGAAGATAATAATAACAAGCTAAAACCTTAAACAGATATTTTAATTTTTTTTTCATTAATTTTAAAACTATAATAGTGACAACTTAAATAAATATAACTATATTATTTTAATCAGTCAAATAATAATAAATGTTTCTTGAGCACCAAACTAGCATATTGAAATAACTTCTCACTCAAGAACATTTAAGACACTGGAGTAATGGTCTGCAAAATTCAGCTTTTCCAACAATTATGAAGTGTAGATTTTGACAATGAACATCTAATGTGCTTTGCTAGTTTTGCAAAACTCTCAAATGATTCTAAGCACCTTTATCCACCATATCCACGTTAAAGTATTGTAATCACTCAGTGTCTTCTTCTCCTTTTGTGATTGGCAGAGATCCGAGCTCAGTTGGTGGAGCAGCTTAAGTGTTTGGACCAG[C/T]AATGTGAGCTCCGTGTGCAGCTCCTGCAAGACCTGCAGGACTTCTTCCGCAAGAAGGCAGAGATTGAGATGGACTACTCCCGCAACCTAGAGAAACTAGCTGAGAGGTTCCTGGCAAAGACACGCTACACAAAAGACCCTCAATTCAAGTAAGAGAGCCTTTGTGTTGGTACATTACAGCAGCTGTGCTTCCATCCAGCTATTTGAATGCACATTTTAGGGTATTGCATTAAAAGAAACACTCAGTGGAAACTGCAAGATGCACGTGAATGCAAAAATATGCATAATAATCAGAATCTGAATTGCTAGGTATGTTTACACAGACGTGAAACTTGTTTTCATGAAAGAAATTTCCACAGTGCAACTAATTGACAGTGACTGTGCAAATACACAAATAATAAATGAATAATAATAATAAAATGAGATTATGTACAAATAAATTAAGTGCAAATACTTTTTTATTATTTGTTTAAACTTCCCAGGTTCTGCTGGTTGTAGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27771
Status:
No KASP design
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Essential Splice Site 386 1100 9 22
ENSDART00000103865 Essential Splice Site 386 1100 10 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22280105)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21286336
GRCz11 11 21446904
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGTAATATTTCTGACAAATGTGAACTATAATAGTTATGCTGTTCCTCC[A/T]GGTTAAGAAGACCATGGAGGCCACTTTACAGACCATCCAGGACATGGTGA
Long Flanking Sequence:
TTAAATCCATAATTTAAGTGTAGGGAATTGAATGCCTTTCCAAAACCTCAGTATTATATGTGCTGCTGTAGTTATATTAACAATTATAAGGGAGAACACATCATTTTTAAAATATGGAACCTCAGTTTTATCACCTAAAAGACATATCCTAGGTGAGAGAGGAATGTTAAATGCCAGGCATCTGCCTAATTTTTTTAACACAGATTCCCTAAAGGGTAAAATCTTTGTACACTACCATAAAGCATGGAAGTATGTGCCAATCTCTTGTTCACATTTCCAGTGTTTTTTATCATCCAAACATCCCATTGAAAATCTATAATTTATAGATATATAATATAGATATAATTTATTATATTACAATATTTGAATTCAGTGCACCCGTTTATACGACATTAAAACACTTGATGAATCAATCCAAAGCGGGAATTCCTAAATCAATCACTTACTTTGGTTGTAATATTTCTGACAAATGTGAACTATAATAGTTATGCTGTTCCTCC[A/T]GGTTAAGAAGACCATGGAGGCCACTTTACAGACCATCCAGGACATGGTGACCATAGAGGACTTCGATGTGACCGACTGCTTCCACCACAGCAACTCAATGGAGTCGGTCAAGTCCACAGTGTCTGAGTCTTTCATGAGCAAACCCAGCCTGGCCAAGAGACGAGCCAACCAGCAGGAGACCGAACAGTTCTACTTCACGGTAAATGAGACTGAGTAGCAGAGAAACCAGTTTAGTACGGGGTCATTGGGTTGAGGGACGCATGCGGTGGATTGGACGATGGTAAATCTGAGGGCATTGAAGGACAAGAAGGGAAAAGGCAAAGGAAGGGTGATGAAGGGAGAAGATAAGAGATTGAATGTTGGAGATAGAGCTTAATGTCTATTCTTCTCTATCAGAGCCTTTTAAGAAGCCTTTGACTGAGAAGAAGGCAATTAGAGGAGAACGCTGCTGTTGACCAGCCTCCATTGATCTGCGCTTGTTTGTAGACTAATGAAACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Nonsense 394 1100 9 22
ENSDART00000103865 Nonsense 394 1100 10 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22280078)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21286309
GRCz11 11 21446877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAATAGTTATGCTGTTCCTCCAGGTTAAGAAGACCATGGAGGCCACTT[T/A]ACAGACCATCCAGGACATGGTGACCATAGAGGACTTCGATGTGACCGACT
Long Flanking Sequence:
TTGAATGCCTTTCCAAAACCTCAGTATTATATGTGCTGCTGTAGTTATATTAACAATTATAAGGGAGAACACATCATTTTTAAAATATGGAACCTCAGTTTTATCACCTAAAAGACATATCCTAGGTGAGAGAGGAATGTTAAATGCCAGGCATCTGCCTAATTTTTTTAACACAGATTCCCTAAAGGGTAAAATCTTTGTACACTACCATAAAGCATGGAAGTATGTGCCAATCTCTTGTTCACATTTCCAGTGTTTTTTATCATCCAAACATCCCATTGAAAATCTATAATTTATAGATATATAATATAGATATAATTTATTATATTACAATATTTGAATTCAGTGCACCCGTTTATACGACATTAAAACACTTGATGAATCAATCCAAAGCGGGAATTCCTAAATCAATCACTTACTTTGGTTGTAATATTTCTGACAAATGTGAACTATAATAGTTATGCTGTTCCTCCAGGTTAAGAAGACCATGGAGGCCACTT[T/A]ACAGACCATCCAGGACATGGTGACCATAGAGGACTTCGATGTGACCGACTGCTTCCACCACAGCAACTCAATGGAGTCGGTCAAGTCCACAGTGTCTGAGTCTTTCATGAGCAAACCCAGCCTGGCCAAGAGACGAGCCAACCAGCAGGAGACCGAACAGTTCTACTTCACGGTAAATGAGACTGAGTAGCAGAGAAACCAGTTTAGTACGGGGTCATTGGGTTGAGGGACGCATGCGGTGGATTGGACGATGGTAAATCTGAGGGCATTGAAGGACAAGAAGGGAAAAGGCAAAGGAAGGGTGATGAAGGGAGAAGATAAGAGATTGAATGTTGGAGATAGAGCTTAATGTCTATTCTTCTCTATCAGAGCCTTTTAAGAAGCCTTTGACTGAGAAGAAGGCAATTAGAGGAGAACGCTGCTGTTGACCAGCCTCCATTGATCTGCGCTTGTTTGTAGACTAATGAAACTGTGTTACTTTGTAATTCTCCACTAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045391 Nonsense 926 1100 21 22
ENSDART00000103865 Nonsense 926 1100 22 23

The following transcripts of ENSDARG00000032161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 22247096)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21253327
GRCz11 11 21413895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAGACTAAAGTAGARGGTCCTCAAGTTCGCAAATCCACAYCTACTGGA[C/T]GATCCAAGAGCTTCAGCAAYCACAGACCCCTCGACCCAGARGTRATCGCG
Long Flanking Sequence:
CCCTTAACAAGTGGGAGGAACATATGCAAACTGTTGTAATTCCTACAGCGTTCACCTGATTTGGATGTAAGTACCTTCAAATTAAAGCTGATAGTCTGCAGTTAAAGTACATGTTGTTTGTTTTATTTTAAATCTATTGTGTTGGTGTATAGAGCCAAAAATGTTAGAATTGTGTCGATGTCCAATTGTTTATGAACCGAACCGTTCAAAGACAAATAAAAGAGTGTATGTGAGAGTTTGTACTTACACATATTTATCTCAGGTTGAGGAAGCGTCCAGAAGCGACGAGCATCCGGAGAACCATCCGGCCTGTGGAGGAGGGCTCATCAGGAGCAGCAGGGGGCTTAAAGACCTCCTCTATGCCTGCTGGAGGACTGGCCAAGGACAGCTCAGACAAGCGTCCTGTCAGCGCTCACAGCGTCCTGAACTCCATCACCAGACACTCGTCTCTCAAGACTAAAGTAGAGGGTCCTCAAGTTCGCAAATCCACACCTACTGGA[C/T]GATCCAAGAGCTTCAGCAACCACAGACCCCTCGACCCAGAGGTGATCGCGCAGGTGGAGCACAGCTCACAGGTACGGGACACTTCAGAAATATTATTAGAAACAAGCAGCATTCAAACCCTGTCAGCTTTCATCTAAACTTTCTGGCTCAAGCAGACATCACTGTTGTCCAATCACAACCCATTAGGCAAATGATGACATCAAACTTACATCTCAGTTGATAAAGTATGTAAATCAAACTGATGTCAGAATCTTGACATGGTTTTGTTTTGATGTAAATTGAATGGCAAACATATTGGCATTCATGTCATTAAACCAATTTAAGTGTTATTAACCCCCCCCCTACCCCCACCCCCTAAATAATCACCGATATCACTGTCCAAACTGAATTTATAATTATGTTACAGCATCGTGATCAAGTCTTAAGTAACAACTTATCAGAATGATATCAAGACCTGCCAGAAAACAATTTGTGTGGTAGTTAATATATGCAAATATATG
Associated Phenotype:
Not determined