Busch Lab

ZMP

zgc:171776

Ensembl ID:
ENSDARG00000032156
ZFIN ID:
ZDB-GENE-071004-36
Description:
hypothetical protein LOC571939 [Source:RefSeq peptide;Acc:NP_001103190]
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27341
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043067 Essential Splice Site 85 219 4 9
Genomic Location (Zv9):
Chromosome 9 (position 8439320)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8419163
GRCz11 9 8397493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGTAGATCCTGATAGGTGTTATCCAGAAATTTCTCTAGTACCTGAATG[G/A]TTGGTTCTTCTGTTATGATTCCAGATTATTGGCTTATTTATGCTTAGTTT
Long Flanking Sequence:
GCTGATGGCCTTTCCATCACCATATGATCGTAAGTGTTCCGGAAATTGCTAGCAAGTTAACATTAATTTGATCTAATGTATTAACTTCTCTTGTTTGTCACAAATGTAGGCTAAAATTTTTATCTATGAGACTTTAAACACCTGCTACTTATTTATTTTTGCCTCATTTTAATGTGATTAACTTTAATGGTCTCACTCAAACTGGATTGTCAGAATGTGGCGTTTTATTTTTTCCTCTTCCCAGACACTGTAATTACATGTCTGGATTCAGACCTTCATCTCCGTTGTGGTAAGATCTAGTCATGTTATATTAAAGTTGATCAATGTAATACTGCGGTTTTAAAATGAGATTTTTTTTTGTTCTTTTAAGATTATGGTGTTATCTTCGTAAAGTCATCAAGATTTGGTTGGCGGAGCACCCGCACTTGTGGGCCTGCAAGGTCTCGTTTTGAAGTAGATCCTGATAGGTGTTATCCAGAAATTTCTCTAGTACCTGAATG[G/A]TTGGTTCTTCTGTTATGATTCCAGATTATTGGCTTATTTATGCTTAGTTTTTTTTTTTTTTTTTAATTTTATTTTTATTTGGAAGTGAGTTGTATTTATTCCTGAACAGGTGTAATGGACGAGCGGAGTGTATGATCAACAAGGAAAGGATTGCAAGACCACATCATTGTTTTCACACTCATTACATCACCACCCATTTTTGTGTCCCAGCAAGTATGGATGGTTTGTCTTTTCCAATGAATTTTCCTTATCTTTGCAAACCTGTAACCTTCCTCTGTTGTTTTCCAGAGACTATTAAGGTTTGTGAACGTGACCGTGAAATCTTAAGATGTGGTGAGCTAGATTTTCAATATTTTGTTATCTCTGTATTAGGACCCTAATAAAATAAAATAATAAAATTAAATAATAAAATAAATTAAATAAAATTAATAAGGAATGCATTCATTCATCTCCATAGAACATGGTAGGATTAAGATACTTGCTGCAAATTATGGACGTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18937
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043067 Nonsense 132 219 6 9
Genomic Location (Zv9):
Chromosome 9 (position 8439645)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8419488
GRCz11 9 8397818
KASP Assay ID:
2260-1498.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTTTTCCAGAGACTATTAAGGTTTGTGAACGTGACCGTGAAATCT[T/A]AAGATGTGGTGAGCTAGATTTTCAATATTTTGTTATCTCTGTATTAGGAC
Long Flanking Sequence:
GTAATACTGCGGTTTTAAAATGAGATTTTTTTTTGTTCTTTTAAGATTATGGTGTTATCTTCGTAAAGTCATCAAGATTTGGTTGGCGGAGCACCCGCACTTGTGGGCCTGCAAGGTCTCGTTTTGAAGTAGATCCTGATAGGTGTTATCCAGAAATTTCTCTAGTACCTGAATGGTTGGTTCTTCTGTTATGATTCCAGATTATTGGCTTATTTATGCTTAGTTTTTTTTTTTTTTTTTAATTTTATTTTTATTTGGAAGTGAGTTGTATTTATTCCTGAACAGGTGTAATGGACGAGCGGAGTGTATGATCAACAAGGAAAGGATTGCAAGACCACATCATTGTTTTCACACTCATTACATCACCACCCATTTTTGTGTCCCAGCAAGTATGGATGGTTTGTCTTTTCCAATGAATTTTCCTTATCTTTGCAAACCTGTAACCTTCCTCTGTTGTTTTCCAGAGACTATTAAGGTTTGTGAACGTGACCGTGAAATCT[T/A]AAGATGTGGTGAGCTAGATTTTCAATATTTTGTTATCTCTGTATTAGGACCCTAATAAAATAAAATAATAAAATTAAATAATAAAATAAATTAAATAAAATTAATAAGGAATGCATTCATTCATCTCCATAGAACATGGTAGGATTAAGATACTTGCTGCAAATTATGGACGTACAGACGATACCACCTGCTTGAGAAGACGACCATACTGGCGGCCCCTGAACACAAACTGCTACTCACCCAACACACTTGATCTTGTGTCAAAAAGGTATGGATTGAGCAAACTACTCACTCCTTTTCAACTGGGTGTTTTCCCCAGTTAAAGCAAGGAAAGTGCAAATCTGCAAAGGTACTTGGGTTTATGTTCCTGTAGCCCTTTAATAGTGTCAAATTCAGTTCCTGGAGGGCTGTAACTAGGCACAGTTTTGGTCCTGCCCTGCTTTAAAATACTTTCCTGTAGGTTTCAAACAAGCCAAACAGACTCCGATTGATCAGGTTTT
Associated Phenotype:
Not determined