Busch Lab

ZMP

scg5

Ensembl ID:
ENSDARG00000032126
ZFIN ID:
ZDB-GENE-040426-1687
Description:
neuroendocrine protein 7B2 [Source:RefSeq peptide;Acc:NP_957020]
Human Orthologue:
SCG5
Human Description:
secretogranin V (7B2 protein) [Source:HGNC Symbol;Acc:10816]
Mouse Orthologue:
Scg5
Mouse Description:
secretogranin V Gene [Source:MGI Symbol;Acc:MGI:98289]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43463 Nonsense Mutation detected in F1 DNA Not yet available
sa17856 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43463
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045249 Nonsense 119 219 3 6
Genomic Location (Zv9):
Chromosome 20 (position 29499890)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29571103
GRCz11 20 29473982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAAAGATTTCAGCGAGGACCACGGTTATCCTGACCCTCCCAACCCTTG[C/A]CCCCTTGGAAAGACTGGTATGCAGGTTCAAATGCTCTAATATAGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045249 Essential Splice Site 124 219 3 6
Genomic Location (Zv9):
Chromosome 20 (position 29499873)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29571086
GRCz11 20 29473965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCACGGTTATCCTGACCCTCCCAACCCTTGCCCCCTTGGAAAGACTG[G/A]TATGCAGGTTCAAATGCTCTAATATAGTGGAACATCAATTCATTCTGTCA
Associated Phenotype:
Not determined