Busch Lab

ZMP

six4b

Ensembl ID:
ENSDARG00000031983
ZFIN ID:
ZDB-GENE-010201-1
Description:
sine oculis homeobox homolog 4b [Source:RefSeq peptide;Acc:NP_571792]
Human Orthologue:
SIX4
Human Description:
SIX homeobox 4 [Source:HGNC Symbol;Acc:10890]
Mouse Orthologue:
Six4
Mouse Description:
sine oculis-related homeobox 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106034]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15756 Nonsense Available for shipment Available now
sa14754 Nonsense Available for shipment Available now
sa23674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 91 615 1 3
ENSDART00000112537 Nonsense 91 545 1 4
Genomic Location (Zv9):
Chromosome 20 (position 20557366)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20585533
GRCz11 20 20485206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGCGCTGATGCAGGGTGGGAACGTGGACCGCCTGGCCAGGTTCCTGTG[G/A]TCACTACCGCAGAGTGACCTSCTGCGGGGGAACGAGAGCATCCTGAAGGC
Long Flanking Sequence:
TGCTGCACGCTTGATGGACGTTCCCACCGCAAACATTTATCTTCACATCGCAGTCGCTCCTCCCCGTAGAAGCGGCGAATCAAAACGCGCTCAGGACTTGGAGTCCTTTCCAACGTGGGCTGTGGAGTTAAACTTGTGGTAGAACGGGGGACGCCAGATCTTATCCACTCCACGCAGCGGCCAGATACCTGATCGTGCTTGGATGGAGGGGCGAAACCCGATCGCCTGATGTGCTGCCTGAAACCCAGAGGAGTGACTTATCAGGACGCGTTCAAAATGTCTTCTTCCTCAAGCGAGGTCATTAGTGCCGATGAGATCAAGAGGGAGAGTCGTGGGAGTGTCAAGCTGTCAGTGCTGGACCCCGCGGAGTTGCCGATGGAGAATGCCGAACTTTTGGACTGCTCGCCGGCCTCCCTGGCCTTTTCCCCCGAGCAGGTCGCGTGCGTCTGCGAGGCGCTGATGCAGGGTGGGAACGTGGACCGCCTGGCCAGGTTCCTGTG[G/A]TCACTACCGCAGAGTGACCTCCTGCGGGGGAACGAGAGCATCCTGAAGGCGCAAGCGATAGTCGCCTTCCACCATGCCCGCTACCAAGAGCTCTACTGCATCTTGGAGAACCACTCTTTCAGCCCGTCGAACCACTCGTCTCTGCAGGATATGTGGTACAAGGCGCGCTACACCGAGGCGGAGAAGGCGCGAGGCAGACCGCTGGGTGCCGTGGACAAGTATCGCTTACGCAGGAAATATCCGCTGCCTCGGACTATCTGGGACGGAGAAGAGACCGTGTATTGTTTCAAAGAGAGGTCTCGGAACGCGCTGAAGGATATGTACAAGCGGAACCGGTACCCATCTCCAGCCGAGAAGCGAAATCTGGCAAAAATGACAGGACTTTCCTTGACGCAGGTCAGCAACTGGTTCAAAAACAGGAGGCAGAGAGACAGAAATCCATCAGAAGCGCAATCGAAGAGGTAGGACGCTGCCGTAGTTATATTTATATCGTTAACTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4134
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 188 615 1 3
ENSDART00000112537 Nonsense 188 545 1 4
Genomic Location (Zv9):
Chromosome 20 (position 20557655)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20585822
GRCz11 20 20485495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCGCTGCCTCGGACTATCTGGGACGGAGAAGAGACCGTGTATTGTTTC[A/T]AAGAGAGGTCTCGGAACGCGCTGAAGGATATGTACAAGCGGAACCGGTAC
Long Flanking Sequence:
CAAGCGAGGTCATTAGTGCCGATGAGATCAAGAGGGAGAGTCGTGGGAGTGTCAAGCTGTCAGTGCTGGACCCCGCGGAGTTGCCGATGGAGAATGCCGAACTTTTGGACTGCTCGCCGGCCTCCCTGGCCTTTTCCCCCGAGCAGGTCGCGTGCGTCTGCGAGGCGCTGATGCAGGGTGGGAACGTGGACCGCCTGGCCAGGTTCCTGTGGTCACTACCGCAGAGTGACCTCCTGCGGGGGAACGAGAGCATCCTGAAGGCGCAAGCGATAGTCGCCTTCCACCATGCCCGCTACCAAGAGCTCTACTGCATCTTGGAGAACCACTCTTTCAGCCCGTCGAACCACTCGTCTCTGCAGGATATGTGGTACAAGGCGCGCTACACCGAGGCGGAGAAGGCGCGAGGCAGACCGCTGGGTGCCGTGGACAAGTATCGCTTACGCAGGAAATATCCGCTGCCTCGGACTATCTGGGACGGAGAAGAGACCGTGTATTGTTTC[A/T]AAGAGAGGTCTCGGAACGCGCTGAAGGATATGTACAAGCGGAACCGGTACCCATCTCCAGCCGAGAAGCGAAATCTGGCAAAAATGACAGGACTTTCCTTGACGCAGGTCAGCAACTGGTTCAAAAACAGGAGGCAGAGAGACAGAAATCCATCAGAAGCGCAATCGAAGAGGTAGGACGCTGCCGTAGTTATATTTATATCGTTAACTGAGAATGGAAAGCGTATGAAGGAATGCGCGAGACCGAATGGAGGACACGTTTCAGCAATGTTTTGAAATACGAAGCTTTGAGCGCTTCAATGAGGTGTACTTTTGAAGAACGTGGAGCCGGTGACGCGTTCACTCTTAAAAATAAAGGTTACTCCGTGGGTCTTTTCAGTTATTAAACTTGATCAATGAATCATTTTCGTATCCAAAGACAATTTGAAGGTTTCTTGAGCTGCCTGTATATCCATATAATTAAATGTTATCGATGTTACGTTATATCTATGGCTACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 297 615 2 3
ENSDART00000112537 Nonsense 297 545 2 4
Genomic Location (Zv9):
Chromosome 20 (position 20559747)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20587914
GRCz11 20 20487587
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACAGCCCCCCCTACAGTTTACTCAGACGGMGGAACAACAGTCATCCAR[C/T]AAATAGGAGATGTCAAAATGCCCTCACACTCAGGTGGAGGAATGAGTTAT
Long Flanking Sequence:
AGTGTTTATTTATTTATTTATTTTTACTATGGAAGGTTTTTTTTACAACAGGCTTTTAGCTTTCCTCAAAATATCTTCTTTTGTCTTCAACAATATAATGAAACTCATAATGGTTTATAATCACTTGAGAGTAAATAATGAGTATTTTTTTGGGTGAACTTTCCCTATTAAATCAATAAATATAATTAAAAAAATAAACAGACCAAACTAAAAGTACTACTGGTAAAGGTATTTTTGAAACAAATGAAAAAAAGAAATAAATAAAAATAAATACATAAATAAAATTCAAACCAAGCCAAAAAATAATAAATGGTCTGTTTTAAACATTTCTTTTTTTATTTTTCAGTGAGTCGGATGGCAATCACAGTACAGAAGATGAGTCCAGTAAAGGCCAAGAGGACTTGTCACCACGTCCCCTCTCAAGCGGCTCTTCCAGCTCAGTCCCACACGGAACAGCCCCCCCTACAGTTTACTCAGACGGAGGAACAACAGTCATCCAA[C/T]AAATAGGAGATGTCAAAATGCCCTCACACTCAGGTGGAGGAATGAGTTATAATGGTGACCTTGCGAGCGTCAATGCTCACTACATCAACAGTGGAGCTTATGGTCACTCACACAGCAGCAATGCTCTCCTGAACGGACTTGGCGCCACAGGTGGCCATTTCTTGACCTTTGATCCTCAGAGGGTCTCCCATCACAGTCAGGAAAGGCTGTTAGGTGGGTCTTCCGTGTCTTATGCTCCATTCTCAATGGGAGTTTCTGAAACAGCCTCTGGAAAGATAGATACCATGCAGACTTTAGTTTCCAATGGTGAGGATGGAGTCATTTCTTCAGTGGTGTCCTTTGCTTCGGCCCCCTCCACACCATCCACTACCTCAGGGGGCCTTCATCTCAGCAGTTACAGCGTGGTCAATCTCCCTGGAAATGAATCTACAATGGGTCTTCCTCCTCTAATGCTGCCTCCATCATCAACATCATCCACTCACGGTAGGAAGACCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23674
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 302 615 2 3
ENSDART00000112537 Nonsense 302 545 2 4
Genomic Location (Zv9):
Chromosome 20 (position 20559762)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20587929
GRCz11 20 20487602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTACTCAGACGGAGGAACAACAGTCATCCAACAAATAGGAGATGTC[A/T]AAATGCCCTCACACTCAGGTGGAGGAATGAGTTATAATGGTGACCTTGCG
Long Flanking Sequence:
ATTTATTTTTACTATGGAAGGTTTTTTTTACAACAGGCTTTTAGCTTTCCTCAAAATATCTTCTTTTGTCTTCAACAATATAATGAAACTCATAATGGTTTATAATCACTTGAGAGTAAATAATGAGTATTTTTTTGGGTGAACTTTCCCTATTAAATCAATAAATATAATTAAAAAAATAAACAGACCAAACTAAAAGTACTACTGGTAAAGGTATTTTTGAAACAAATGAAAAAAAGAAATAAATAAAAATAAATACATAAATAAAATTCAAACCAAGCCAAAAAATAATAAATGGTCTGTTTTAAACATTTCTTTTTTTATTTTTCAGTGAGTCGGATGGCAATCACAGTACAGAAGATGAGTCCAGTAAAGGCCAAGAGGACTTGTCACCACGTCCCCTCTCAAGCGGCTCTTCCAGCTCAGTCCCACACGGAACAGCCCCCCCTACAGTTTACTCAGACGGAGGAACAACAGTCATCCAACAAATAGGAGATGTC[A/T]AAATGCCCTCACACTCAGGTGGAGGAATGAGTTATAATGGTGACCTTGCGAGCGTCAATGCTCACTACATCAACAGTGGAGCTTATGGTCACTCACACAGCAGCAATGCTCTCCTGAACGGACTTGGCGCCACAGGTGGCCATTTCTTGACCTTTGATCCTCAGAGGGTCTCCCATCACAGTCAGGAAAGGCTGTTAGGTGGGTCTTCCGTGTCTTATGCTCCATTCTCAATGGGAGTTTCTGAAACAGCCTCTGGAAAGATAGATACCATGCAGACTTTAGTTTCCAATGGTGAGGATGGAGTCATTTCTTCAGTGGTGTCCTTTGCTTCGGCCCCCTCCACACCATCCACTACCTCAGGGGGCCTTCATCTCAGCAGTTACAGCGTGGTCAATCTCCCTGGAAATGAATCTACAATGGGTCTTCCTCCTCTAATGCTGCCTCCATCATCAACATCATCCACTCACGGTAGGAAGACCTCATTTACTTAACTTCTTGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19232
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048110 Nonsense 473 615 3 3
ENSDART00000112537 Nonsense 473 545 3 4
Genomic Location (Zv9):
Chromosome 20 (position 20563440)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20591607
GRCz11 20 20491280
KASP Assay ID:
2261-4168.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGGATGTGCTCCTTTGGGCAACGTAGTCAGTGACTCTTCCCAGCACT[C/A]AAGCCAAACTCTGCTCTACTCCCAGACTGTAAAGCAGGAGCCCCTGGATG
Long Flanking Sequence:
CGTTAATGTTCAACAAAGAATCATTGATAATCGATAGTGTGTTTATTTCAATTGTTTTAAAATCAAGTAATGCACCCTTCATTCAAAAATCTCTCACTTGTAATATGTAAGCATTTTTACTGTACAAAACCTGTCAGTGAACGATTAGGGCAAAAACATTAAATAAATAAAATATTCCTTTATTAATTGTAATCGAATTAAAATGCTAATTTAATCAAAATTTTGATTTTGGCCAAATCGCCAAGCCATATTTATGTGTTCCACTCAATTACAGTAGCAAAACTAGCATTTTTAAAATGTAGAATTTTGTAATTCCTTTGACAGAATCCAAAACATGCAACTTTGTTTTATCGTAACATGTGCTACTTCATGAATTCATTCATTTACTATGATTAGCAGACATAGTGAACTACATTAACTGAACTTGATTATACTTCCTCTTTTATCCCTAACAGGATGTGCTCCTTTGGGCAACGTAGTCAGTGACTCTTCCCAGCACT[C/A]AAGCCAAACTCTGCTCTACTCCCAGACTGTAAAGCAGGAGCCCCTGGATGTGCCTGGAAGCTATGCTTATCCTTCTGATATGCCCCTGGACCAAGGTAGCAACCTGGGCTATACAGCCTCCCTTTTCCTCTCGTCGTCCTCCAGTAGTGGTTCTCTTCCCTCTACCATCACAGCTACAGTCACCTCAACCCTCTCCAACTCCGATGTCCACCATGCTCTGAATCAAGCAGGACGTGGCCTCCAAGAGGATGGTGTAGCTCTGTCTTCAGACTACAGGTCTCAAGACATCCATCTGCCCAACAGCCTGCAGGTTGTTTCTAGGGAAGGAGAAGGTCCAGTCAGGGTTGTTTGTGGGGATTTGGATATGGAGGGGAAAGAGCTGGCCAAGCTGCAGACTGTACAGATGGACGATGATGGAAGCGACCTCTGATGATGTCAATAATGCATTTCACTCGTGCTGGACTGGTTTTGTCACGCCGCATTGTGCCCTTATGGACGCT
Associated Phenotype:
Not determined