Busch Lab

ZMP

abcf1

Ensembl ID:
ENSDARG00000031795
ZFIN ID:
ZDB-GENE-050517-31
Description:
ATP-binding cassette sub-family F member 1 [Source:RefSeq peptide;Acc:NP_998351]
Human Orthologue:
ABCF1
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:70]
Mouse Orthologue:
Abcf1
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 1 Gene [Source:MGI Symbol;Acc:MGI:1351658]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23550 Nonsense Available for shipment Available now
sa23549 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7881
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31688404)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30855693
GRCz11 19 30443006
KASP Assay ID:
2261-3444.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGGGAAAAAGGGCAAGAAAGCTGCTGCAGCTGCTAAACCATCTAAGG[T/C]TAGTGAYTCTTGTTTTGAKGATTGATTRRTTTCAAAGAGGCGTTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19215
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31688404)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30855693
GRCz11 19 30443006
KASP Assay ID:
2261-3444.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGAAAAAGGGCAAGAAAGCTGCTGCAGCTGCTAAACCATCTAAGG[T/C]TAGTGACTCTTGTTTTGATGATTGATTGGTTTCAAAGAGGCGTTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23550
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 None None 877 None 27
ENSDART00000073705 None None 241 None 9
ENSDART00000112123 None None 274 None 26
ENSDART00000113290 Nonsense 264 845 15 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31687370)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30854659
GRCz11 19 30441972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGGTTTGTTGTAGCGTCAACCAAACCACAAGAGCTGCAGAATGTTTA[T/A]GTATATTCTATTTATGAAGCCATACTTATCTATGCATTAATTGCATGTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa43303
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Nonsense 525 877 18 27
ENSDART00000073705 None None 241 None 9
ENSDART00000112123 None None 274 17 26
ENSDART00000113290 Nonsense 493 845 22 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31682340)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30849629
GRCz11 19 30436942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTATTTTATGCACCAAAGTCATATATCACTTACTTTCTTTTTAAGCTA[T/A]CTGCAAAGCTGGAAAAAAACACTCCTAATTGTGTCCCACGACCAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Nonsense 719 877 23 27
ENSDART00000073705 None None 241 None 9
ENSDART00000112123 None None 274 22 26
ENSDART00000113290 Nonsense 687 845 27 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31678525)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30845814
GRCz11 19 30433127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTAGCTTTTCTTTATTTTAGACAAAAGGAGAGATGAGGAAGAACCAT[C/T]GATTGGTAAGCCAGATGTATAAAATCACTCGACTTATTGTCACCACATTT
Associated Phenotype:
Not determined