Busch Lab

ZMP

si:ch73-374a13.2

Ensembl ID:
ENSDARG00000031782
ZFIN ID:
ZDB-GENE-041008-100
Human Orthologue:
AIM1
Human Description:
absent in melanoma 1 [Source:HGNC Symbol;Acc:356]
Mouse Orthologue:
Aim1
Mouse Description:
absent in melanoma 1 Gene [Source:MGI Symbol;Acc:MGI:109544]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15726 Essential Splice Site Available for shipment Available now
sa23087 Nonsense Available for shipment Available now
sa36420 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Essential Splice Site 247 1001 None 23
ENSDART00000139451 None 204 947 1 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25370114)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25510033
GRCz11 17 25528424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTTGAATCTGACTTCCAACACGTCTAAWTCAAASATTGTGCTGCAAGG[C/G]ATATCAGGATTAACATCTCCATCAGACATCACTCAGCAGATTCCATTGTC
Long Flanking Sequence:
GTCACAGTCACTGAGGAGAATAATGATGGAGAAAAACAAACCGCAGAAGGCTCTGGAAAAATGTCCTCGAGGTTAGAAAGAATGTCAATCATCTCAAACCTTGTGAACTCTCCTAACACCTCACGAAAAGTAAGAACTGAACCAAGCAATCTTATCAATGGGATTCAGTCACCCATAACACCACCAGCAGAGGTGATGCCAACCTCAGGAAAGACTAAAGACATGCCGCTGTCCCAGGTCGCCAAAGCACCAAAAGAGAGGCTTGGCGACTTTCCTGATCCTGGCATTGTAAAAGGAGGACCTGGTGATTTAGTAATAAGCCCAACCACATGTCCTCCTCTTCCAACTTTCACAGACGTCAAGTTGCCTGACTTTTTGGAGAAATACATGAGTAAAGGCAAAGAACCAAGCACAGTGAGCCAGCAAAAGCCTGACACTGTCACTGCACTGGATTTGAATCTGACTTCCAACACGTCTAAATCAAACATTGTGCTGCAAGG[C/G]ATATCAGGATTAACATCTCCATCAGACATCACTCAGCAGATTCCATTGTCCACACCCACCAGCCTCTCTCCAACATATGCACAGGTAAGAGAATGCTGATAATCTCTGCAGTTTTAAAAGATTACTCTTTTAAGTTGAAAAAAAAAGGCTAACAATATTTGCCTTTAAAATATATATTTTAAAATGTTTTCGTATTTTATTTTGACATAATTTGTGTCCATTTATGCTGCCAGATATTTTAGAAAGAAGTATCTTATGCTCAGCAAGGCTGCATTTATTTACGAATATAGTAAAACAGTAACAACGACTGAATTTTATTAGTTGTTAATTTAATAAAAACAATGACAACTTTTGATGTTGCATTATTAGGCTTTAACTAAGATTAATAAATGCTTTTGTAGTTTTCATTTTTAAATTAACTTGTTAATAAATGGAACCTTACTGTACAGAGTTAACGAAGAAAAGGCCTATAAATAGTCAAAGAATTTTCAGAATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23087
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Nonsense 413 1001 9 23
ENSDART00000139451 Nonsense 361 947 5 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25372630)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25512549
GRCz11 17 25530940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTACAGCACACCACAAATTGACCTGTTCACAGAGCTCAATGGGATGGGC[C/T]GAATATCTTCATACTGCGATGACACAATAGAAACCTGTTCTTTTGGCCTT
Long Flanking Sequence:
CTCTCTCCACTCATCTCCATAAAGGTCGTCAGAGGATGGTAAGAACAATCACATTCATCTGACTAGTCATGTAATACTTAAAATGCTGAGTTTGCTATTTTTTTGTCCTGTTAGCTGGCTTTTATATGAAAAGCCAGGCTTCCAGGGTCGATCCATCGCTCTGGAGGAGGGGCCAGCGGACATAGCAAATGAGTGGGCGGACACAGAGCCCAGTGAGGAGGTGGAGCAAAATGACTCAGCACTCCCATCCACACCCATGGTTATTGGATCTATTAGGCTTGCATTAAGGGTGAGTCTAAAATCACGAGTCCACACTTGACCTCAATTTTCTGATTAATTAGTCTTATTAGCCACAGAATCTCTTAAATACAAAATATATTTCATGTTCTGACAAATGCATATGAACCATAAGCTTGTTTTGATTACTTGATACTATATCTTTTTCTCAGGACTACAGCACACCACAAATTGACCTGTTCACAGAGCTCAATGGGATGGGC[C/T]GAATATCTTCATACTGCGATGACACAATAGAAACCTGTTCTTTTGGCCTTCCTCAGAGTACTGGATCGATTAAGGTCCACAGTGGAGTGTAAGTGAGCTTCTGGGCTTAAATAAATGCTCACATTAAAATAATAAATGCATAACATTAAAATAATGTGTTTAGAAATTCTTCAGCTTTGTTTTTTTACATTTTTATCTTGGTGATATTTTGATACACACTATTGTTTACTAGAGATGTATTGATTTATTGTGAACCTGTTGAAAATTGATTCAAATATGTGACAATTCAAACCGGCAGAAATGTTAAATGAATGGTGATACATATTTTAAACAGAGGGGGTGCTGTGTGTTTGTTATTTAAATTTGTGACTAAATCGTATTGTAAGATTAGTGATCATGAATTGTATTAAATCGTGAGTCAGGCGAATCGTTACATCCCTACAATTTACAAATTTTGGGATGGTACATTTTTAAAAATTCTTTTTTAAAGTCTCTTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Nonsense 517 1001 12 23
ENSDART00000139451 Nonsense 465 947 8 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25376175)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25516094
GRCz11 17 25534485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCCGATGTTTCAAGGGGAGTGCATGGAGATAGAAAGAGACATTTA[C/A]AACTTTGGAGAGGTAGAGGAGAATGAAGAAGAGGAGACTGACAGCACCAG
Long Flanking Sequence:
CAATAATGGCAATAATAATTTAATGGGAAAATGGTTTATTTTTATTTATATTTTTTACTTCAACTTAACTATAAATAACTCTGCAACATCTAGCAATCATTTAAGGATGACAAGACTGCTTGATATCTGTAAACATGCTATTTGAATGCTTCATCAATAGACATTGTACTGATTATAGGTGACTTTGCAAGTACACTTTAATTTATGCAGCTAACCCTAGCACTTTAATGAGAGTCTGTTGACATGTAGTTGCAAAATGACTTGTAGTCAACAGAATGCCTAATCCAAATAAAGTGAAACCATGAGTGTTCACATTCTAAGTTTAAATGAAGTTTGATCCTGTCTCTCTCATAAGTTAAATTTGCTGTTCACAGGAATTATTCTAAATATGCAGGAAGTTCTACAGTTTTTCTTATTTCTCTCTCAATCTGAAACCAGGCATTACTCTTTGAAAAGCCGATGTTTCAAGGGGAGTGCATGGAGATAGAAAGAGACATTTA[C/A]AACTTTGGAGAGGTAGAGGAGAATGAAGAAGAGGAGACTGACAGCACCAGGAGAAACAGACTCCGTTCTGTCGGCTCATTAAAGATCCTCAGTGGCATGTGAGTGAATTTATCATGTTTAGAAGATCAATTTTACACACATCTTTGTTTTTTGCTAGCTTATTTGGTTTGCCTGGATCTGACAGTGAGTTGTGTTGTTGTTCACCTATAGCTGGGTTGGATACTCTGCACCAGGGTTTGATGGTCGCCAGTACCTTCTGGAGGAAGGAGAGTATGCTGACTTCACAGATTGGGGTGGACTGGAAGAAGGGCTGCTCTCTATACGTCCTTTGCTGGCAGTATGTACAAGCACATCATTTCTGTCTTGAGATTAATACTTGATAAATAAAAACAATGTATGCTCACATACACTCAGAAATACAGATTTTCTAATATTGTTTTTTATGTACTGTATGTGTTTACAATTTATTTTGGACAAATTGTTGTATATTTCGGAAAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28860
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 None None 1001 None 23
ENSDART00000139451 Essential Splice Site 641 947 12 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25380789)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25520708
GRCz11 17 25539099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTTTTGTGTCACAGGATCAGGCTGAAGGACTGTCCAGATATAAGG[T/G]AAGTTTAACGAAAATGTGTAAATTAGTGTTGTAATTCCACATAATATAAA
Long Flanking Sequence:
TTAACAGTCTAAAATCTAGTTTACTTTAGATCTTCTCTATAATCTATGCTAATAAGTGATATGTTGCCTTCGGTCTGAGATTGATTAATGGAAATATATCTGTTTTCCTGAAGTTCATGGCAAATTGGAAGTAAATGTGGATCTTATTGGTTTTACTTGTAAAAAAAAAAAAGCCAATCAGTCAAACTCTTTAACATGTGTCTGAACAGGTGGATAGCGTTCGAAAAGGAACGTTTCTCAGGTGAAATGTACATTTTGGAGAAGGGTCTCTACGGCTGTCCTGAAGATTGGGGAGCACGCAACAACAGAATTTTGTCTCTGCAGCCTGTGGTTTTGGTAATCATTTGTCTGCAATAGCTGCCCTACTTTTGCAATGTTATCTTTGCTATAGTTGCATTGTTGCTTAATAACACTTTGATTTTTTTATTTGTGCTGCCATCACATCTCATATGTTGTTTTTGTGTCACAGGATCAGGCTGAAGGACTGTCCAGATATAAGG[T/G]AAGTTTAACGAAAATGTGTAAATTAGTGTTGTAATTCCACATAATATAAAACACATTGTACACATTTTATAGCCTGATATGCATCTGAATATATTATTAACCTGAATTAACCTGAGAGAAACACACATCCCCAATGGGCACACAGCGTCATAAGATGTTATTATTAGGTTAGATTTAGGTTATGATGTTAGGTGCCCAAAATTCAGTGTCTAACCTGCGTCCAAGGACAACATTATTTTGATGTCTAGCAACGACGTTAAATGATGTTGATATTTGGTTGATTTTAGGTTGTTTTAGAAAGTGACCAAAATCCAATGTAGAGCCAACATCTTTAACCAACAGCATATTAACGGCCAATACTGACATTTATTTGTCTAGTATGACAACCAAAATCTAACATCTGATAGACATCATAGTGGCAACGTCAACACATCCTCAAGCTTTAACATTATAAGACGTTGACATTTGGTTGTTTTTAGGTTGTGTTGGAAAGTGACCAA
Associated Phenotype:
Not determined