Busch Lab

ZMP

myst2

Ensembl ID:
ENSDARG00000031770
ZFIN ID:
ZDB-GENE-030131-1901
Description:
histone acetyltransferase MYST2 [Source:RefSeq peptide;Acc:NP_997800]
Human Orthologue:
MYST2
Human Description:
MYST histone acetyltransferase 2 [Source:HGNC Symbol;Acc:17016]
Mouse Orthologue:
Myst2
Mouse Description:
MYST histone acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2182799]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38873 Nonsense Mutation detected in F1 DNA Not yet available
sa45448 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27877
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004896 Essential Splice Site 5 568 None 15
ENSDART00000142659 Essential Splice Site 5 102 None 3

The following transcripts of ENSDARG00000031770 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6682215)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5965135
GRCz11 12 5998719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAAAGCGGCGATTGGATTTATCGGAGGGAACATGCCGCGGCGGAAGG[T/G]GAGAGAAAATGCGAGAACTGGGTCAGTAGCCCAGTCGGCTGAGCGCGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38873
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004896 Nonsense 139 568 4 15
ENSDART00000142659 None None 102 None 3

The following transcripts of ENSDARG00000031770 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6677593)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5960513
GRCz11 12 5994097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCGATCCCTCTCATCGGCCAAAACGCCGCCGCTTTCATGAGAGCTA[C/A]AACTTCAATATGAAGTGCCCCACACCTGGGTGCAATTCTCTGGGTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45448
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004896 Nonsense 394 568 11 15
ENSDART00000142659 None None 102 None 3

The following transcripts of ENSDARG00000031770 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6670847)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5953767
GRCz11 12 5987351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTCTGCTTGCTGGCCAAGCTGTTTTTGGACCATAAAACACTGTATTA[T/A]GATGTGGAGCCTTTCCTGTTTTATGTCATGACTGAAGCTGATAACACAGG
Associated Phenotype:
Not determined