Busch Lab

ZMP

smad6b

Ensembl ID:
ENSDARG00000031763
ZFIN ID:
ZDB-GENE-050419-198
Description:
hypothetical protein LOC564395 [Source:RefSeq peptide;Acc:NP_001038516]
Human Orthologue:
SMAD6
Human Description:
SMAD family member 6 [Source:HGNC Symbol;Acc:6772]
Mouse Orthologue:
Smad6
Mouse Description:
MAD homolog 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1336883]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100569 Nonsense 347 486 4 4
Genomic Location (Zv9):
Chromosome 18 (position 19479352)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19709575
GRCz11 18 19698641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGTGGGCCGCCTCTATACGGTGTACCAGCCTGCCGTCAGCATTTTCTA[T/A]GACCTACCTCAAGGTACGGGCTTCTGCCTTGGCCAGCTGAGCCTGGACCA
Associated Phenotype:
Not determined