Busch Lab

ZMP

C3AR_DANRE

Ensembl ID:
ENSDARG00000031749
Description:
C3a anaphylatoxin chemotactic receptor [Source:UniProtKB/Swiss-Prot;Acc:P0C7U4]
Human Orthologue:
C3AR1
Human Description:
complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
Mouse Orthologue:
C3ar1
Mouse Description:
complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa1173 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa1173
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040271 Nonsense 127 321 1 1
Genomic Location (Zv9):
Chromosome 10 (position 1928451)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1872314
GRCz11 10 1900028
KASP Assay ID:
554-1083.1 (used for ordering genotyping assays)
KASP Sequence:
AATTCTCCCCTCAGTAATAGTCATAARCATGTTCGCCAGYGTTTTCACCT[T/G]AAACATAATCAGCCTGGATCGCTTCACACAGGTTATCACTCCGGTTTGGG
Long Flanking Sequence:
TTTTTGTTAAATATTTTTTCATTTGCGTTTTTCAAATTGTCCAACTTTTTCTGATTTGGGGTTGTAAATGACTGAATGTCTGCTTATGTCAATCCACAGCATCAGCAAAACAAACTACATATTTCGAGTCTCTGCCATGGATGAAAATTATGAGAACTTCACAGATGCGTATGAAGAAATGTGGGGTTTTGATGCAAATGAGACGAATACCTTTGCATCTTCAGAAGTGAGGGTGATTTCTCTGGTCGTCTACTGCCTGACGTTTCTCCTCGGAGTCCCCGGAAACTCGTTCGTCATATTCATCGCAGGAATGAAGATGAAGAGGACCGTTAATACAATCTGGTTTCTCAATCTAGCGACTGCCGACCTCCTGTGCTGTCTTTCCGTACCGCTAACTGTAGCCGAAATCCTCCTAGACCACCATTGGCCGTACGGATACGCCATGTGCAAAATTCTCCCCTCAGTAATAGTCATAAGCATGTTCGCCAGCGTTTTCACCT[T/G]AAACATAATCAGCCTGGATCGCTTCACACAGGTTATCACTCCGGTTTGGGCTCAGAATCATCGAAGTTTATTGCTAGCGCGGCTGTCTTGCGTTGCGGTATGGATTTTGGCTTTGCTGCTCAGCTTGCCCTTCATGATATTAAGACGAACTTATGAAGAGTTTAACATGACAGTTTGCACTTTCGATGACGACGACTTCACGACATACGGAGCTTTGAGCATCGTCAGGTTTGTGTTTGGCTTTTTAATTCCTCTAATGTCCATCGTGACATGCTATGGAATTATCGCTCGCAAATTAGGCAGTCGTCATTTCCGCAGTGGCCGAGCGTTTCGCATCATGCTGGCTGTTATCGTGGCTTTTTTCCTGTGCTGGATGCCGTATCATGTGTTGGATTTGATACGAAGCTATGGAGGGGAATCCAGTTCAATGGTGGCTTTGAAAGTGGATCCGTTGGCCATCTCTTTGGCGTACGTGAACAGCTGCCTGAACCCCGTCCTGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461