Busch Lab

ZMP

D1LXJ4_DANRE

Ensembl ID:
ENSDARG00000031702
Description:
cGMP dependent protein kinase I [Source:UniProtKB/TrEMBL;Acc:D1LXJ4]
Human Orthologue:
PRKG1
Human Description:
protein kinase, cGMP-dependent, type I [Source:HGNC Symbol;Acc:9414]
Mouse Orthologue:
Prkg1
Mouse Description:
protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16398 Nonsense Available for shipment Available now
sa41962 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16398
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043236 Nonsense 21 684 1 18
Genomic Location (Zv9):
Chromosome 12 (position 6897597)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6180517
GRCz11 12 6214101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACGCGATCTCCAGTACGCGTTACAGGAGAAGATTGAAGAATTGAGACAG[A/T]GAGACGCGCTTATCGACGAGCTGGAGTTGGAGCTCGACCARAAAGACGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27880
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043236 Nonsense 221 684 4 18
Genomic Location (Zv9):
Chromosome 12 (position 7042297)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6325217
GRCz11 12 6358720
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTGACCGGCAGTGTTTCCAGACCATCATGATGAGGACAGGACTCATC[A/T]AACATGCAGAGTACATGGAGTTCCTGAAGAGGTGAGCCCTCACTGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043236 Essential Splice Site 231 684 4 18
Genomic Location (Zv9):
Chromosome 12 (position 7042329)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6325249
GRCz11 12 6358752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGGACAGGACTCATCAAACATGCAGAGTACATGGAGTTCCTGAAGAG[G/A]TGAGCCCTCACTGCTTTCATTTCTATTCATTCATCTCCAACCCCTGATGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27881
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043236 Essential Splice Site 310 684 7 18
Genomic Location (Zv9):
Chromosome 12 (position 7078162)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6360893
GRCz11 12 6394396
KASP Assay ID:
2260-4945.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCGTGCATTAGGAAAAGGAGACTGGTTTGGAGAAAAAGCTCTTCAAGG[G/A]TAAGAACTTATACTTATACAGAGCTGCAATCGCATCTGGCTGCTGTCCAT
Associated Phenotype:
Not determined