Busch Lab

ZMP

mylk2

Ensembl ID:
ENSDARG00000031698
ZFIN ID:
ZDB-GENE-080616-2
Description:
myosin light chain kinase 2-like [Source:RefSeq peptide;Acc:NP_001103990]
Human Orthologue:
MYLK2
Human Description:
myosin light chain kinase 2 [Source:HGNC Symbol;Acc:16243]
Mouse Orthologue:
Mylk2
Mouse Description:
myosin, light polypeptide kinase 2, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:2139434]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24378 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5060
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Nonsense 328 555 5 12
ENSDART00000133801 Nonsense 527 777 9 16
Genomic Location (Zv9):
Chromosome 23 (position 32291664)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32126554
GRCz11 23 32053085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATGCAGGTCATGAACCAGCTGAGCCACCCCAACATCCTCCAGCTTTA[T/A]GAGGCCTTCGAGGTCAAGAATCAAGTCGTGCTCATCCTGGAATAGTGAGT
Long Flanking Sequence:
AGTGCGATATCAATGCTGAAACAACATATTGTGCAGCCCTAGTGTAAAGTAACAAATTACAAATACTGAAATTACTGTAACTGAGTAATATTTCTTAGGCATTGTGCTTTACCATGTAGTTTTACGAATGTGTATTTTTACTTTCAATCCAGTACATTTTTAGTGCTGTATTGACCCCTTTACTCCACCTGCAGTCACTACCTTATTTTTTCTTTTCTATGGTGATTGGCTGAGTAGAATAATCAGTCTTTTGATTTCCATCCAATCAAATCACACATAGAAAAAATAATTTAAATTGAGATATTTCAGTAATTTGATGGCCATTATTCTTATATACAGCCATTACAAAAGACCAAATATATCCTTTTAAGTAAGAAAGGACCATTTTGAGTTTCTGATCAGGACATGATATGACTGTTCTCTTGTTTTTACCAGGACATGGCACTGAATGAGATGCAGGTCATGAACCAGCTGAGCCACCCCAACATCCTCCAGCTTTA[T/A]GAGGCCTTCGAGGTCAAGAATCAAGTCGTGCTCATCCTGGAATAGTGAGTAGAAGCAACCCTTTATACAAGCGTTACATGGAGTATGAACCTATTGATAGTCTTGTTTTCTGTAGTGTGGAGGGAGGCGAGCTGTTCGAGAGGATTGTGGATGAAAGCAGTCCGCTGACGGAGGTGGATGCGATGGTGTTTGTGAAGCAGATCTGTGAGGGCGTTCAGTACATGCATCAGATGTACGTGCTTCATCTGGACCTTAAGGTAACAGGCAAAGCAGGAAGGGTCAGATTTAGACTTCTGTTCTCATGCAGATTGTCTGGGATTATAGAGTAAGCAGTTATGGTATATGCTGTTTTAGACAATAACGTTGAAGGGAAATGTCAGTCATAAATAGACCTCAAGGCAAATTTAGGGCAGCCATTATGTTTATTGTCTTGAAATTTGTTGTTCAGTGATTTTTGGAACAACCGTTTAATTTTCCATTAAAAGAAGATCATATACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24378
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Nonsense 418 555 8 12
ENSDART00000133801 Nonsense 617 777 12 16
Genomic Location (Zv9):
Chromosome 23 (position 32294935)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32129825
GRCz11 23 32056356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTATGCTTTGACTAACTTTTCTCTTTGTCCCTCTTCAGATATAAACCA[C/T]GAGAGAAGCTCAAAGTTTCATTTGGAACGCCTGAGTTTTTAGCTCCAGAG
Long Flanking Sequence:
ATTTTGTCAATGTTTTGGAGCACACTACCTAATAGATATCCTTAAAAACTAACAATACTAATGATACTAACGTCTAAAAAACATTATTTTAATTTCATGGAACCTTTAAACCTCTAATATGGTTTGCATAGAGTTGTTTTTTGTCTGACAGCTTTAAAACGCGGTGATGATCCAACAGTTTATCACTTTCTTTTTCAGCCAGAGAACATCCTCCTTGTTAATCGCTCTAGCCATCAGGTGAAAATTATCGACTTTGGACTAGCCAGGAGGTGGGATTTATACCATGATATTGTTCTTACCCGTGCAGGTTTATGTGTTCGAACAAAGATTAGTGTTGTCATCAGCCATTTTAACTGGCCTGACATTTGCCTTACATACTTTTCCAGTGACAAGCGTGTATTTTTGCATGTGTTAATCCCTTGGGAGTCAAATATTATAGCCGAGGCTTATTTTTATGCTTTGACTAACTTTTCTCTTTGTCCCTCTTCAGATATAAACCA[C/T]GAGAGAAGCTCAAAGTTTCATTTGGAACGCCTGAGTTTTTAGCTCCAGAGGTTGTGAACTTTGATTTTGTCTCCTTCCCTACGGATATGTGGACTTTGGGAGTCGTCACTTACATGCTGTAAATCACACCAAATTCATGTTGCATCGTTCTGTGTTGTAATTTCAATATATGGTCAAAGTTGCGATATACAAAGTCAGAATTGGTATGGGGAAAAGTCAGAATTTCAGATAGAAGATAGAAAGTCAAAACTGAAGATATAGTCAGAGTAGTGTGTGTGTGTGTGGGGGGGGGGGGGATGGGGGGTGTAAGAATTGACAGAAAGAGGTAAGAATTTTAGGGAAAAAAGCAAGAATTGTGAAAAAAAGGTAATTATTAAGGGGGGGGGGGAGTAATAATGGTGAGGAAAAGGGTAAAAATTGAGGGAAAATGTAAGTATTGTGAGAGAAAAAGGTAAGGATTGTAAAAAAGGTAAAAATTGTGTCAGAAAGGGGTTAGGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19331
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Essential Splice Site 552 555 11 12
ENSDART00000133801 Essential Splice Site 751 777 15 16
Genomic Location (Zv9):
Chromosome 23 (position 32297926)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32132816
GRCz11 23 32059347
KASP Assay ID:
554-7046.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTCACAGGTTCTCCTCAAGAAATACATGGCCAGGCGATTGTGGAAGG[T/G]AAAACACTGTGTTTAGAAAGTGGCAGATCATTGTGTCCTCAGTTTTAAAG
Long Flanking Sequence:
TTGTGTTCATGAAAAATGTGAAAAACTTTCAATCTAAAAATGTGTTATGAAGCAGCGCCCCCTTTTGGATGTATGTAGGTACTTCGACGAGGACGCTTTTGAGCACGTGTCTGCTGACGCGCGGGACTTTGTTTCCAACCTACTGATCAGAGAAAGAAGGTAACGTAAAATGAAAATACAAGTTCATCATCATCATATTTTAACGCTTGGCCACTCCAAAATCACATAATTGTGTTTAGTTGAACACAATATTCGCATACAGTGACTATATAGTGGCACTCAAGTTAAAACAACAACTGTATTTTGTATGACTTTTGTATATTCGAAAGATTATAGGTGTTTGTTTTTAATTCATCATCTTTTTAGTGGTCGTATGAGTGCCACACAGTGTCTCAAACACCCATGGCTCAACAACATCTTTGAGAAAGCCAAAAGCAGTAACATCGTGCTCAAGTCACAGGTTCTCCTCAAGAAATACATGGCCAGGCGATTGTGGAAGG[T/G]AAAACACTGTGTTTAGAAAGTGGCAGATCATTGTGTCCTCAGTTTTAAAGTACTAAATGCTCTCTTGCTCTCCTTCTATACAGAAAAACTACATAGCTATCGCTGCAGCAAATAGGTTCAAGAAGATTGGAAGTTCAGGTTCCTTGACCTCACTTGGAATCTGAGTATGTTCAAACTCTTATAATACACAGGTCATGTCTTTGTATTGCTGTGCCGCACTGCAAATCACCTTTCACCTCTGAAGTTTGACTGGCTGCTGATTTTAATTGCATTGGTAAACCACACAAATCTATAATGTGCAAGAACCATTTATTTATACAATACATATATATCTTGTATATTGTTTCAAGCATTCATAAATTAAACGTATAGCTATAAACACTCACCGGCCACTTTATTGGGTACACCTTACTAGTACAGGGTTGGACCCCCTTTTGGCTTCAGAACTGCCTTAATCCTTTGTGGCATAGATTCAACAGGGTACCGGAAATATTCCTGAG
Associated Phenotype:
Not determined