Busch Lab

ZMP

si:ch211-207d6.2

Ensembl ID:
ENSDARG00000031658
ZFIN ID:
ZDB-GENE-070912-185
Human Orthologue:
KIAA1217
Human Description:
KIAA1217 [Source:HGNC Symbol;Acc:25428]
Mouse Orthologue:
Etl4
Mouse Description:
enhancer trap locus 4 Gene [Source:MGI Symbol;Acc:MGI:95454]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17408 Nonsense Available for shipment Available now
sa15875 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3384
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056750 Essential Splice Site 718 1841 12 25
ENSDART00000131376 Essential Splice Site 699 825 10 12
ENSDART00000139247 None None 97 None 3

The following transcripts of ENSDARG00000031658 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29597184)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29898819
GRCz11 2 29882352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGGCCGTCAACTTGCGCAAAGTAGGAGAGGCTCTGGCCACACTCAAAG[G/A]TAATTACATCTGTACTTTTTGGGCCTATGGACTGAAGTCAACCCTCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17408
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056750 Nonsense 1279 1841 20 25
ENSDART00000131376 None None 825 None 12
ENSDART00000139247 None None 97 None 3

The following transcripts of ENSDARG00000031658 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29605087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29906722
GRCz11 2 29890255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTWCATACACACTTGYCTGTCTCACAAGCCTCAGCTGCTCCTGATAAGT[C/G]AAAGCATAAACATCGGGCAACCACTGTTCAAGTTACGCTTGTCAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15875
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056750 Nonsense 1647 1841 21 25
ENSDART00000131376 None None 825 None 12
ENSDART00000139247 None None 97 None 3

The following transcripts of ENSDARG00000031658 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29606268)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29907903
GRCz11 2 29891436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGACCAGARGAAGCCAGTCCCACAAAGAGGCCTGCACCTCTGAAGCCC[A/T]AACCTAGCAAGTCATCGCTGCAAAAAAGATCTAAAACACAGTCTCGAACC
Associated Phenotype:
Not determined