Busch Lab

ZMP

g6pca

Ensembl ID:
ENSDARG00000031616
ZFIN ID:
ZDB-GENE-031001-4
Description:
glucose-6-phosphatase a, catalytic [Source:RefSeq peptide;Acc:NP_001003512]
Human Orthologue:
G6PC
Human Description:
glucose-6-phosphatase, catalytic subunit [Source:HGNC Symbol;Acc:4056]
Mouse Orthologue:
G6pc
Mouse Description:
glucose-6-phosphatase, catalytic Gene [Source:MGI Symbol;Acc:MGI:95607]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35207 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032050 Nonsense 197 353 7 7
ENSDART00000106435 Nonsense 196 347 6 7
ENSDART00000130159 Nonsense 196 348 6 7
ENSDART00000131301 None None 133 None 4
ENSDART00000139419 Nonsense 196 352 6 6
Genomic Location (Zv9):
Chromosome 12 (position 6707598)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5990518
GRCz11 12 6024102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTATTTCCAGGTATAATTGTAGCAGAAACCTTCTCCAGAGTGCAGTG[G/A]ATCTATAGTGCGAGTCTGAAGAAGTACTTCAGCATCACGCTGTTCCTGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2666
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032050 None 347 353 7 7
ENSDART00000106435 Nonsense 346 347 7 7
ENSDART00000130159 Essential Splice Site 346 348 6 7
ENSDART00000131301 None None 133 None 4
ENSDART00000139419 None 346 352 6 6
Genomic Location (Zv9):
Chromosome 12 (position 6707148)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5990068
GRCz11 12 6023652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCCCACTGCACTTGTTCCTGGAATCATGTACTGGATTACACAAAAAAG[C/T]AAGCATGAGAAGGACATGTAGTGGATATATTTGTGCAAAACTTGCCATTC
Associated Phenotype:
Not determined