Busch Lab

ZMP

calb1

Ensembl ID:
ENSDARG00000031598
ZFIN ID:
ZDB-GENE-030131-8107
Human Orthologue:
CALB1
Human Description:
calbindin 1, 28kDa [Source:HGNC Symbol;Acc:1434]
Mouse Orthologue:
Calb1
Mouse Description:
calbindin 1 Gene [Source:MGI Symbol;Acc:MGI:88248]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22901 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7799
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045190 Essential Splice Site 116 271 None 12
ENSDART00000145697 Essential Splice Site 105 260 None 11

The following transcripts of ENSDARG00000031598 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 38190589)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36831072
GRCz11 16 36784956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAAATGNNNNNNNNNNNNTAAGCACTAACCTCATTTAACTTATTTTTC[A/G]GGCTTGGAGAATATATGATGCTGATCACAGTGGATACWTTGAAGCTGATG
Long Flanking Sequence:
TATTCAGCTGATAAACAACACTTCATGCACTCAATGCTCATGTAGCAGAAGGGTAAGAGCTATTGGGCACTAAGGTTGGATTTATTTGTTTATTTTTACAGGTACTATTTGGTAGTTTGGTCCTTCAATTAATTTAACTGAAAGACAGTTTGCATTTTCATTTAGTAAAAATAGAAAAAAAAACTGTGTTCCATTTAGGACAACAATAAACTCATGCACATGCTTGAGTGTGTTAGTGTATAAGTGCATAGTCTGATTTGGGACGCAACTAGTAACATACAAAATTACTTGCTCAGAAACATTATAAATGTCTAAATAAGAGTCATAAAATTCAAAAAGCCTCTGATGATGTTCTTTTAGACTATTTGTAATCAAATGCATCTTTGGGGAGCATTCTTTCAAACTTTTAAATGGTAGTCCATGCTCCACATGCTCTTTTAAAAGTGCAAGTTTAAATGCAAGTTTAAATGTAAGCACTAACCTCATTTAACTTATTTTTC[A/G]GGCTTGGAGAATATATGATGCTGATCACAGTGGATACATTGAAGCTGATGAGCTGAAGGTAGGAAACCAATTTTAACCACTTTAGATCTTACCGACAAAACTCTTTAGAAACTCAACCTTTAATGATCTACAGAGATAAATATGAAGTCTCAGGAGACCTAAAGATAATAACACTAATCTTAAACCTAATATTGTACCAACAAATACAGTACATACGGTGTGTTGCTTTGACCTATAGAAAGGACACCGCCAGTACTGTAAAAAGCTCTAGCTTACAACAAAGCTGACATGCTCTTTTCAGAAAGGTGACAAATCCACCATGGTGACATTTCAGGTTCTGTTTGATCACACCAAAACATAAAGAACAATACAGTGAAGCAAAACATACGTGCTGCATTATTCCATCGTCGAAAAATAAAATAACAACTGTAGGCCTATGGGAGTTTAATATAAATTTCTAGGATATCTATAAATTGACATATCCTGTTTGACTAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22901
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045190 Nonsense 244 271 12 12
ENSDART00000145697 Nonsense 233 260 11 11

The following transcripts of ENSDARG00000031598 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 38172227)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36812710
GRCz11 16 36766594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTTCTCATCTCCGACAGGTTCTAGAAGCCAACAAAATCTCCACGTA[T/G]AAGAGTGCCATCATGGCTCTGTCCGACGGAGGCAAGCTCTACAGAACAGA
Long Flanking Sequence:
CACTTTTAAAATTTACAAAAACTCTTTACAGAACGTGATCTATACTTAATATTCAATAGATTTTTGGCATAAAAGAAAAATTGATGATTATTGGCTATTTCCGAATATGTACCTGTGCAATATAAAATTAATTTTTTGATCCAGGTTTACATACTGTACATACACTGCAAAAAATTAAAAATAATTGGATTTACAATTTTTTTTTTAAGGTAACTGGTTTCAAACTATTTATATGGGCTGGATTTAAACAAACAAATTAAACTTAGTAATGTTCAACTTAATTAGTTTGTTTCCATTCAGCTCATATAAATTGTTACCTTAAAAAAAAAGGGTAAATCCAACAAATAAATTTTTTTTTGTGTGTATATAATAATACATCTACTGTATATGTTTTGATTTGGCTTTTACAAACATCACTACACGTCTGAACACAGCCTTTGAGACTAAATATGCTCTTCTCATCTCCGACAGGTTCTAGAAGCCAACAAAATCTCCACGTA[T/G]AAGAGTGCCATCATGGCTCTGTCCGACGGAGGCAAGCTCTACAGAACAGAGTTAGCGCTGGTGTTGTGTGCAGAGGAGATGTGAACATCCATCCCCACCCCAAACCCGTCCCCTGCTCACCTGTGACGCGTAACGTAGCTAGAAACCTCTTGTGTTCTTTCATTTCCAACATCGATTTCACTTAGACAGGCGACCAACAGCACATACTTTTCCATTTGTTGTTTCTATACTGTTTCTAAGTGTACAGATTTTTTAAAGAGCACACGCGTACAATACTTAAAACATACACAAACATTTCCCTTGACGAAAGAGGAAACCCAACATGATAATGAATCATAATCCAAAATATACTATTCCAGCAATGATATGCATAGACAAAAGCAATAATGCCAACAAGAAATGCTGAAGAAAAAAAAACAAAAACATGGCCTGTTGGTGGAATCTGTGTAATACTCCAAATTTGACCTTTGCGATGCATGTTTGTAGCTGACGGCAGGCCT
Associated Phenotype:
Not determined