Busch Lab

ZMP

tada2a

Ensembl ID:
ENSDARG00000031562
ZFIN ID:
ZDB-GENE-060929-508
Description:
transcriptional adapter 2-alpha [Source:RefSeq peptide;Acc:NP_001070609]
Human Orthologue:
TADA2A
Human Description:
transcriptional adaptor 2A [Source:HGNC Symbol;Acc:11531]
Mouse Orthologue:
Tada2a
Mouse Description:
transcriptional adaptor 2A Gene [Source:MGI Symbol;Acc:MGI:2144471]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22601 Nonsense Available for shipment Available now
sa42511 Nonsense Mutation detected in F1 DNA Not yet available
sa35833 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22601
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 118 421 5 14
ENSDART00000130670 Nonsense 118 445 5 15
Genomic Location (Zv9):
Chromosome 15 (position 14809958)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15854921
GRCz11 15 15790943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCGCTCTAAAACCAAAGAAGAATGTGAAGGTCACTACATGAAGAACTA[T/A]ATCAACAATCCTCTGTTCTCCTCCACTCTGCTCAGTCTCAGACATATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42511
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 149 421 5 14
ENSDART00000130670 Nonsense 149 445 5 15
Genomic Location (Zv9):
Chromosome 15 (position 14810049)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15855012
GRCz11 15 15791034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATATGGATGATCATCTGTCCCGGACAGCAGACACAGCCATTCCCTTC[A/T]AGCGTAAGTGAGCAGCAAAAACAACAGAAGCAACTGTTGTGTGATTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35833
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090939 Nonsense 372 421 14 14
ENSDART00000130670 Nonsense 396 445 15 15
Genomic Location (Zv9):
Chromosome 15 (position 14838207)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15883170
GRCz11 15 15819192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGTCGCTCAGCTGTGTCAGGTGGTGCGGCTGGTGCCCGGGGCGTA[T/A]CTGGAGTACAAACAAGCCCTGCTGAATGAGTGCCGGCGGCAGGGGGGACT
Associated Phenotype:
Not determined