Busch Lab

ZMP

srpk1b

Ensembl ID:
ENSDARG00000031560
ZFIN ID:
ZDB-GENE-070112-2292
Description:
serine/arginine-rich protein specific kinase 1b [Source:RefSeq peptide;Acc:NP_001074138]
Human Orthologue:
SRPK1
Human Description:
SRSF protein kinase 1 [Source:HGNC Symbol;Acc:11305]
Mouse Orthologue:
Srpk1
Mouse Description:
serine/arginine-rich protein specific kinase 1 Gene [Source:MGI Symbol;Acc:MGI:106908]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21830 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21830
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042972 Nonsense 71 658 3 16
Genomic Location (Zv9):
Chromosome 11 (position 2784331)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2736069
GRCz11 11 2805423
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTCTGCAGGAGCAAGATGAAGAGATCCTGGGCTCCGATGATGAAGAA[C/T]AGGAGGATCCCAATGATTACTGCAAGGGTACGAGTCATGCACGCATAACA
Associated Phenotype:
Not determined