Busch Lab

ZMP

col9a1

Ensembl ID:
ENSDARG00000031483
ZFIN ID:
ZDB-GENE-040426-2410
Description:
collagen type IX alpha I [Source:RefSeq peptide;Acc:NP_998429]
Human Orthologue:
COL9A1
Human Description:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
Mouse Orthologue:
Col9a1
Mouse Description:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35569 Nonsense Mutation detected in F1 DNA Not yet available
sa22364 Essential Splice Site Available for shipment Available now
sa12182 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35569
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Nonsense 10 546 1 24
ENSDART00000131508 Nonsense 145 681 9 32
Genomic Location (Zv9):
Chromosome 13 (position 39711550)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39025651
GRCz11 13 39151541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATTTTGCAAAACAGGGAGCCATGGGTGTGAGAGGACCACAGGGACCC[A/T]GAGGACCAACAGGGCCCAGAGTGAGTATCACTGATAAAAAAATCCAAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28180
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 17 546 2 24
ENSDART00000131508 Essential Splice Site 152 681 10 32
Genomic Location (Zv9):
Chromosome 13 (position 39711211)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39025312
GRCz11 13 39151202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACATCAGATTCAAACTCGATAAAAATAATATAAATTTTTTTGTGTTTAC[A/T]GGGAGCTGCAGGGATGTTGGGTGGATCTATGGAACTGGTAAGAGGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 207 546 13 24
ENSDART00000131508 Essential Splice Site 342 681 21 32
Genomic Location (Zv9):
Chromosome 13 (position 39701639)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39015740
GRCz11 13 39141630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTTGTGAGGTGGTAACCAATGGTATATACCATACTTCTTCCAATGAC[A/T]GGGTAACGCTGGACAACCAGGCCTTATTGGCACTATGGGATCTTCAGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28179
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 372 546 21 24
ENSDART00000131508 Essential Splice Site 507 681 29 32
Genomic Location (Zv9):
Chromosome 13 (position 39687564)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39001665
GRCz11 13 39127555
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTCATATGTTTGTGATATTCTTCTTAACCACTCCTCCTTTGTTCAC[A/T]GGGCAAGGAACCGAGTGATCAACACATCAGACAAGTGTGCATGCGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12182
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
Genomic Location (Zv9):
Chromosome 13 (position 39684695)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38998796
GRCz11 13 39124686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGCGGGGGAACATCVGCACTCATTAGTGCGTYTGCTCTTTGTGCTTTC[A/T]GAGCAGTTGGCACAGTTGGCTGCCAGTCTGAGGAGMCCAGAGTCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4341
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
ENSDART00000045434 Essential Splice Site 390 546 22 24
ENSDART00000131508 Essential Splice Site 525 681 30 32
Genomic Location (Zv9):
Chromosome 13 (position 39684695)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38998796
GRCz11 13 39124686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGCGGGGGAACATCGGCACTCATTAGTGCGTYTGCTCTTTGTGCTTTC[A/T]GAGCAGTTGGCACAGTTGGCTGCCAGTCTGAGGAGMCCAGAGTCTGGAGC
Associated Phenotype:
Not determined