Busch Lab

ZMP

mpp1

Ensembl ID:
ENSDARG00000031475
ZFIN ID:
ZDB-GENE-031113-4
Description:
55 kDa erythrocyte membrane protein [Source:RefSeq peptide;Acc:NP_999857]
Human Orthologue:
MPP1
Human Description:
membrane protein, palmitoylated 1, 55kDa [Source:HGNC Symbol;Acc:7219]
Mouse Orthologue:
Mpp1
Mouse Description:
membrane protein, palmitoylated Gene [Source:MGI Symbol;Acc:MGI:105941]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4159
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099533 Nonsense 218 468 6 14
ENSDART00000125737 Nonsense 218 468 6 12
Genomic Location (Zv9):
Chromosome 21 (position 35379579)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36303792
GRCz11 21 37698318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCCAACTGGTGGCAGGGGAAAGTGGACAGTTCCTCCACAGACTTCGCT[G/T]GACTCATCCCTTCTCCAGAACTGCAGGAGTGGTGCGTTCAATGCCTACAT
Associated Phenotype:
Not determined