Busch Lab

ZMP

dgat1a

Ensembl ID:
ENSDARG00000031465
ZFIN ID:
ZDB-GENE-030131-4600
Description:
diacylglycerol O-acyltransferase 1 [Source:RefSeq peptide;Acc:NP_956024]
Human Orthologue:
DGAT1
Human Description:
diacylglycerol O-acyltransferase 1 [Source:HGNC Symbol;Acc:2843]
Mouse Orthologue:
Dgat1
Mouse Description:
diacylglycerol O-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333825]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39221 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43195 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042517 Essential Splice Site 96 499 2 17
Genomic Location (Zv9):
Chromosome 19 (position 1465638)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1136571
GRCz11 19 1375220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTTTAGCAACTACAGAGGAATCCTCAACTGGTGTGTGGTCATGCTGG[T/C]GAGTGCGTATGCAAATTCATGTTCACAAAACTGCACCATAATCGTAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43195
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042517 Essential Splice Site 426 499 16 17
Genomic Location (Zv9):
Chromosome 19 (position 1480441)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1121768
GRCz11 19 1389999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTCCCGTGTTTAATAGTGCTGATGGGGTTTGATGTTGTTCTGTTCA[G/A]TATTTAGTGAGTGTTCCTCTCAAGATGTTTCGGCTCTGGGCGTTTCTGGG
Associated Phenotype:
Not determined