Busch Lab

ZMP

LOC562928

Ensembl ID:
ENSDARG00000031463
Human Orthologue:
SYT6
Human Description:
synaptotagmin VI [Source:HGNC Symbol;Acc:18638]
Mouse Orthologue:
Syt6
Mouse Description:
synaptotagmin VI Gene [Source:MGI Symbol;Acc:MGI:1859544]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41836 Nonsense Mutation detected in F1 DNA Not yet available
sa38841 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048365 Nonsense 321 471 4 7
Genomic Location (Zv9):
Chromosome 11 (position 25591825)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24420650
GRCz11 11 24658266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTGCAGGAGAGTGTGGATCTCGGAGAGATAATGTTCTCTCTGTGCTA[C/G]TTGCCGACTGCAGGGAGACTCACACTTACAGTCATCAAATGTAGGAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38841
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048365 Essential Splice Site 348 471 5 7
Genomic Location (Zv9):
Chromosome 11 (position 25592087)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24420912
GRCz11 11 24658528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGGAAGATGTGTTGAGAAAAGTGTGTCACACCTCCCTGCTCTCTTGAC[A/T]GATCCGTACGTGAAGGTTTCGCTGATTTGTGATGGGAGACGCTTGAAAAA
Associated Phenotype:
Not determined