Busch Lab

ZMP

trh1

Ensembl ID:
ENSDARG00000031387
ZFIN ID:
ZDB-GENE-020808-1
Description:
trh1 protein [Source:RefSeq peptide;Acc:NP_705956]
Human Orthologue:
LASS4
Human Description:
LAG1 homolog, ceramide synthase 4 [Source:HGNC Symbol;Acc:23747]
Mouse Orthologue:
Lass4
Mouse Description:
LAG1 homolog, ceramide synthase 4 Gene [Source:MGI Symbol;Acc:MGI:1914510]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43758 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43758
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Essential Splice Site 63 407 2 11
Genomic Location (Zv9):
Chromosome 22 (position 4288795)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4327608
GRCz11 22 4711983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTCCCATTGGCCCTGGGGTTCATCGCCCTGCGTTTTGTATTCGAAAG[G/A]TCAGTATCAACGCCGCATATGTTTTCATTTTCATTTCTAGCGAGTCAAAT
Long Flanking Sequence:
ATGCGACAGACGTGGGTAGATCATGAGGAAATGGCGGATGTAGTACGTCTGAGTTCCATTCATACAACTCATACTGCATAGAGTGCAGCTTTCTAACGGTCGAGTAGTACATTTCAATTCAAATGCAGTAGCTACTAAGTTGCAGGCGATATCGGAGGAAGCCCTTGACTTTTCCAAACCACGGTAAACCTTGAAGCCAGTTACTTTTTCATGCCTAGCCAGTTGTCAAAGTGACTTGTTCCATTCAGATTTATCCTCATGATTAGTATATGTTGTAATAAGTTGTCAGCTTTTTAAACTTTCCAGTTCTCTCTCTTCAGATTGGAGGATAACATAAACCGTTGGTTATGGCGGGAAGACTTCTGGCTTCCTCCTGGCGTTACGTGGAAAGACATCGCAGAGGGAACGTCTGACGGAAGTCGGCATCCCGTACCGCGGGATCTGCTCATCTCATTCCCATTGGCCCTGGGGTTCATCGCCCTGCGTTTTGTATTCGAAAG[G/A]TCAGTATCAACGCCGCATATGTTTTCATTTTCATTTCTAGCGAGTCAAATAGCATTCATGTGTAGAAAATGAATAAGGAAATATAAAATGTAAATAAAATAACACTGTATAGTCTTTATTTTAATTCATTCGGTGAAATTAATCTTCATTAAAGTAACAAATGTTGTACTTTTTGTTTTCGAATCTTTTAATCTGTCTTGAAATCCCTTTAAAACACATGCATATGATCAATCTTCAGTCTGTTATGGTTATAGCCTTACTCTACTTTAGATGTCGCCACAGCGGAATGAACCACCAACTATTCCATCATATGTTTTACGAAGTGAATACCCTTTCAGCTGCAACCCAGTACTGGGAAACACCCATAGACTCTTATTTACACACACGCATACATTACGGCCAATTAAGTTTACCTAATTCACCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAGCCCACGCCAACTCGAGGAGAACATGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8362
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Essential Splice Site 103 407 3 11
Genomic Location (Zv9):
Chromosome 22 (position 4293582)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4332395
GRCz11 22 4716770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAACTGGAGGCGTTCTACCTGCAGAAGAAGAAGACTGAGCCGTCACAG[G/A]TGAACAACACCTAAACACCTGACTCATTACCGCACACAYGANNNCATCATCAT
Long Flanking Sequence:
GAAAAAAAGTTAGGTCGGAAGGTAAAACCACACACAGTTTCCTGTAATGGCTAAGGTTTGGTGTAGGCAGATGGAAAACACAGTTTACAGGACAGTATATAAAAAAGGAGGGAACCAATTGAAAGTCCTCACAATTCACAAAAACAAACGTGTTTTTTTGTGTCCGTGTAGGGTCTGTGTAGGGTTTGAAACTGGGTTGAAACTGGCTTCAAGGTTTACCGTGGTTTGGAAAAGTCAAGGGCTGCCTCCGATATCACCTACTACTCAGTAGCTACTGCTTTTGAATTTAAATGCACTACTCGACCGTTAAAAGTGTGCACTCGATACAGTATGAGTCATATGAATACAAACATGTGTGTTTGTGTGTGTGTCTGTGTAGGGTGGTGGCTCTGCCTCTGAGCCGCCGGCTGGGTGTTCGTGACAGGGTTCGGCTTCACATCACACCGATCCCCAAACTGGAGGCGTTCTACCTGCAGAAGAAGAAGACTGAGCCGTCACAG[G/A]TGAACAACACCTAAACACCTGACTCATTACCGCACACATGACATCATCATCAGATCTGACTCGCTCTCCACGCCCTACACTAAAATAAACAACACACACATGTTGGCTTAATGACAAAAAACAAAGTCTGCAGAAAATGAAAAATTTACTGTTTAATTTGAGCACAAAGTTATTCTTACACCGTGTCCTGATTACACGAGACGCGGCACCAAGACACGCAATAAAAGATATCTTTTCCATGTTAAGAGTTTTTGTCCTAACCATCTGTGCTGGTGGCGCACAAAATTTAGGTTTTTATTTCTGCAAACAACACGGCAGGACATTGGTCATTAGGTACTGATTTTGGGCTTTATTCAATGTTAAATGCTACCAATGTTTCAATATTGCCATACTACTGAAAGCAGCAGCCGTTTACCTCAGATCTTAAAAATAAGCAGACGGTTTCAAAATGAAAGTCAAAACTGTGCAAAACCAACAGCATCAGCCTCTCAGTAGCCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4177
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042194 Nonsense 308 407 10 11
Genomic Location (Zv9):
Chromosome 22 (position 4307719)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4346532
GRCz11 22 4730907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACACCGCTGTGGTGGATTCATTGRWCGTATTTTCTCCATACCCTGGCTA[T/G]TATTTCTTTAACGGCCTGTTACTGGTTCTTCAAGCTCTGCACATCTTTTG
Long Flanking Sequence:
ATGTTGGTTAAAAACTAGCTTAGACTGCCATCTGTTGGTTAAAAACTAGCCTAGAGCACCATATGTTAGTTAACAACTAGCCTAAAGCATCATATTTTGGTTAGAAACTAGCCTAGACTGCCATCTGTTGGTTAAAAACTAGCCTAGAGCACCATATGTTAGTTAACAACTAGCCTAAAGCATCATATTTCGGTTAGAAACTAGCCTAGACTGCCATCTGTTGGTTAAAAACTAGTCTAGAGCGCCATCTGTTGGTTAAAAACTAGTCTAGAGCGCCATCTGTTGGTTAAAAACTAGTCTAGAGCGCCATCTGTTGGTTACTAACTAAGCTCAGAATCAATTCAAGAGGGAATAGCAATGCATTTTGAAAATGTAGATATTTAGTCACAGCTCTTGGCAACTGGAAAACACCTCAAATCTAAGGTTTCATGTTTGATTTGCAGAATCGTCTACACCGCTGTGGTGGATTCATTGGACGTATTTTCTCCATACCCTGGCTA[T/G]TATTTCTTTAACGGCCTGTTACTGGTTCTTCAAGCTCTGCACATCTTTTGGGCTTGGCTGATTCTTCGAATGGTTCACAAATTTGTCTTTTTAGGCAAAGTGAGTATCTATGTTGAAAACAAATACTTTATCCTTTCACTTTACATATAAAGCACTTTACAACTACACATGCATGCCAAAGTGCTGGACAAGCAAATAAAGAAAAGCACATAAGATACATAAAAACAAGTCATTTAAACACATTTAGTGATATTATCTCCCTAAATTCATATGGAAATCTGACCTATGTATGGCACTATATATATGAATATATAAATACAGTTGAAGTCAAAATTATTAGCCCCCCTTTTAATTTTTATTTATTTTTTTTATATTTCTCAAATGATGTTTAACAGAGCAAGGACATTTTCACAGTATGTCTGATAATATTTTTTCTTCTGGAGAAAGTCTTATTTGATTTATTTTGGCTAGAATAAAAGCAGTTTTTTTTAACACCATTT
Associated Phenotype:
Not determined