Busch Lab

ZMP

im:7138144

Ensembl ID:
ENSDARG00000031108
ZFIN ID:
ZDB-GENE-041008-137
Description:
Novel protein similar to vertebrate LPS-responsive vesicle trafficking, beach and anchor containing
Human Orthologue:
LRBA
Human Description:
LPS-responsive vesicle trafficking, beach and anchor containing [Source:HGNC Symbol;Acc:1742]
Mouse Orthologue:
Lrba
Mouse Description:
LPS-responsive beige-like anchor Gene [Source:MGI Symbol;Acc:MGI:1933162]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39612 Nonsense Mutation detected in F1 DNA Not yet available
sa32677 Nonsense Available for shipment Available now
sa780 Nonsense Available for shipment Available now
sa39611 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25575 Nonsense Mutation detected in F1 DNA Not yet available
sa38265 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39612
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 454 2861 10 56
ENSDART00000146960 None None 1847 None 34
Genomic Location (Zv9):
Chromosome 1 (position 23035833)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23570405
GRCz11 1 24261234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCCATTCACTCTATAGGAGGAGTCCAGGTCCTTTTCCCTCTGTTTGCA[C/T]AGCTGGATTTCCTCCAACACAGCGGTGACGAGCTGGACACCTCCGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32677
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 594 2861 13 56
ENSDART00000146960 None None 1847 None 34
Genomic Location (Zv9):
Chromosome 1 (position 23030732)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23565303
GRCz11 1 24256132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATGCCATCCGCAGAGTTGGGACCGTACTGCAGGTCATGCACACGCTC[A/T]AGTATTTCTACTGGGTTGTAAACCCACTGGACCGCAGCGGAATCACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa780
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 971 2861 22 56
ENSDART00000146960 Nonsense 358 1847 9 34
Genomic Location (Zv9):
Chromosome 1 (position 23002535)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23537511
GRCz11 1 24228340
KASP Assay ID:
554-0685.1 (used for ordering genotyping assays)
KASP Sequence:
TTATTGAGCTACGTGTAGAGGAGCAGGACAACGATCAGACTGCAGACAAT[G/T]AGGAGATGCAGACCCAGATCCCTGTCACAGTGTCCAACATTCTGGTCAGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39611
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Essential Splice Site 1984 2861 37 56
ENSDART00000146960 Essential Splice Site 1369 1847 24 34
Genomic Location (Zv9):
Chromosome 1 (position 22866717)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23401693
GRCz11 1 24092522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTACTTCTCTTTCTCCATCTCTCTCTTTCTTTCGCTCTTCCTCTCGGC[A/T]GCAGACCGCGGGAGTTCTGGCGCCTGGACTACTGGGAGGATGACCTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25575
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 2213 2861 42 56
ENSDART00000146960 Nonsense 1598 1847 29 34
Genomic Location (Zv9):
Chromosome 1 (position 22820162)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23355138
GRCz11 1 24045967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGCCCGAAACAGCTCTACAAGGCCTCCAACATGACACAGCGCTGG[C/T]AAAGACGAGAAATCTCAAATTTTGAATACCTCATGTTCCTTAACACCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38265
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Nonsense 2240 2861 43 56
ENSDART00000146960 Nonsense 1625 1847 30 34
Genomic Location (Zv9):
Chromosome 1 (position 22818642)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23353618
GRCz11 1 24044447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGACTCTGCTTGTGTTTCAGGCCGTACATTTAACGATCTGAACCAGTA[T/A]CCTGTGTTCCCCTGGGTAATCACCAACTACGACAGCGAAGAGCTCGACCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25574
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025224 Essential Splice Site 2355 2861 45 56
ENSDART00000146960 Essential Splice Site 1740 1847 32 34
Genomic Location (Zv9):
Chromosome 1 (position 22797672)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23332648
GRCz11 1 24023477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTCTAGAGCCTGGAGAAACTGCCAGAGGGACACGTCTGACGTGAAGG[T/A]ATGTTCATGTATATGCATGTCAGTGTACACTGTTATCAAATGTATCAACT
Associated Phenotype:
Not determined