Busch Lab

ZMP

dtna

Ensembl ID:
ENSDARG00000031015
ZFIN ID:
ZDB-GENE-070117-2
Description:
dystrobrevin alpha [Source:RefSeq peptide;Acc:NP_001074050]
Human Orthologue:
DTNA
Human Description:
dystrobrevin, alpha [Source:HGNC Symbol;Acc:3057]
Mouse Orthologue:
Dtna
Mouse Description:
dystrobrevin alpha Gene [Source:MGI Symbol;Acc:MGI:106039]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa31102 Nonsense Mutation detected in F1 DNA Not yet available
sa670 Nonsense F2 line generated Not yet available
sa19346 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44175 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37940 Nonsense Mutation detected in F1 DNA Not yet available
sa37939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31102
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Nonsense 128 710 4 21
ENSDART00000105680 Nonsense 128 714 4 22
Genomic Location (Zv9):
Chromosome 24 (position 37246336)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35861762
GRCz11 24 35749859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGACTTTAACATCTTTTTTTTTTTTTAGGGAAGGTGTGGGGAAGATCT[C/A]GGCTTTTGTGATGAAGATGGCTCTGGCTACTCTTTGTGGAGGGAAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa670
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Nonsense 289 710 7 21
ENSDART00000105680 Nonsense 289 714 7 22
Genomic Location (Zv9):
Chromosome 24 (position 37239151)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35854577
GRCz11 24 35742674
KASP Assay ID:
554-0578.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGGCCACGCATCGGGCAGCCACAGYAACCAGCACCAGATGAAGGAGTA[C/A]ATGTCATGGGTAGGTGAACGTCAGAGCCTCGTCATACAGACTACTCACAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19346
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Essential Splice Site 334 710 8 21
ENSDART00000105680 Essential Splice Site 334 714 8 22
Genomic Location (Zv9):
Chromosome 24 (position 37235059)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35850485
GRCz11 24 35738582
KASP Assay ID:
554-6213.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTTCTCGGATACACCTGAGAAAACACTCAACCTCAATCACATTGTG[T/A]ACGTGAACTCCAACATCCAACACAGAAAAAAAATCACCAGCCTTATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44175
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Essential Splice Site 362 710 9 21
ENSDART00000105680 Essential Splice Site 365 714 10 22
Genomic Location (Zv9):
Chromosome 24 (position 37234737)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35850163
GRCz11 24 35738260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTTTCTCACTCCATGCCTTCCTCAGGAAACCCTTACTCCAGCAAAGC[G/T]TGAGTTTAACACTGCACAATAATTAGTGTTTACATGCCTAGTTCAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Nonsense 462 710 13 21
ENSDART00000105680 Nonsense 466 714 14 22
Genomic Location (Zv9):
Chromosome 24 (position 37223025)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35838451
GRCz11 24 35726548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGGGCAGAGTGCCGACAGACATCTCTCTCTGCTTGGACTCTAATAAA[C/T]AGCAGCGACAACTCATTGCTGAGCTGGAAAACAAAAACAAGTGAGTTCGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30127
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Nonsense 473 710 13 21
ENSDART00000105680 Nonsense 477 714 14 22
Genomic Location (Zv9):
Chromosome 24 (position 37222992)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35838418
GRCz11 24 35726515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTGGACTCTAATAAACAGCAGCGACAACTCATTGCTGAGCTGGAAAAC[A/T]AAAACAAGTGAGTTCGAGCCTGTTTGCTTTGCTGTTGCACACTGATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37939
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042290 Nonsense 698 710 19 21
ENSDART00000105680 Nonsense 702 714 20 22
Genomic Location (Zv9):
Chromosome 24 (position 37214847)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35830273
GRCz11 24 35718370
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGGATCTGGAGAAGCAGCTGAAGATGGAGGAACGGCTCAGACACTCG[C/T]AGGAACCCGACAAGAACCTCCTGGTGAGGCATTACACAGATTCGGAAGCA
Associated Phenotype:
Not determined