Busch Lab

ZMP

mybl1

Ensembl ID:
ENSDARG00000030999
ZFIN ID:
ZDB-GENE-041111-281
Human Orthologue:
MYBL1
Human Description:
v-myb myeloblastosis viral oncogene homolog (avian)-like 1 [Source:HGNC Symbol;Acc:7547]
Mouse Orthologue:
Mybl1
Mouse Description:
myeloblastosis oncogene-like 1 Gene [Source:MGI Symbol;Acc:MGI:99925]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45831 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30099
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066655 Nonsense 33 740 2 16
ENSDART00000146580 Nonsense 33 707 2 15
Genomic Location (Zv9):
Chromosome 24 (position 24402837)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23649715
GRCz11 24 23794889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACGGACCCTGACAGCAGAGAACCCAAGAATTCTAAAAGGACTCTGTG[C/A]AAAATTAAATGGTCCCGAGATGAGGTATGCTTGTGTTTGTAATGTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45831
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066655 Splice Site, Nonsense 41 740 2 16
ENSDART00000146580 Splice Site, Nonsense 41 707 2 15
Genomic Location (Zv9):
Chromosome 24 (position 24402859)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23649737
GRCz11 24 23794911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCAAGAATTCTAAAAGGACTCTGTGCAAAATTAAATGGTCCCGAGAT[G/T]AGGTATGCTTGTGTTTGTAATGTTTAGTTGGGGTTATACTTGGAAGCTCT
Associated Phenotype:
Not determined