Busch Lab

ZMP

vipar

Ensembl ID:
ENSDARG00000030976
ZFIN ID:
ZDB-GENE-040520-1
Description:
VPS33B-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q5TYV4]
Human Orthologue:
VIPAR
Human Description:
VPS33B interacting protein, apical-basolateral polarity regulator [Source:HGNC Symbol;Acc:20347]
Mouse Orthologue:
Vipar
Mouse Description:
VPS33B interacting protein, apical-basolateral polarity regulator Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23664 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4886
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041451 Essential Splice Site 193 483 8 19
ENSDART00000135539 Missense 194 212 7 7
Genomic Location (Zv9):
Chromosome 20 (position 18436939)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18474150
GRCz11 20 18373733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGCTGGATGAAGCCGTTTCTGTTTATGATGGCAATGTCATCACTGCT[G/T]TGAGCTGCAMATCACACTCAATAACCCTATATGGAAAGACTGCTSTGGCK
Long Flanking Sequence:
GTTTTTGGTTTGTTTAGGCATATTTGGTCCGTCTTGCATTCATATTTCAGTTGAGCTGCACCAGAGTTTGTTTGCAACTGGCCAGAGATCCACATTCTTGGCATTCTCTGTCATTGTACAGATACTGTGCTCCACAGTTTTGGTATCCTCTGTCATAACCACCATTTGTTTGGTGTGTGTGGACTACGGTTTAATGGCAGTGTTTACACTTACTGTATTCAAATGAAGTACACTAAAAAAGCAATCACACCAGAGTTTATTTTAATCAAACAACTGTGAACACACCCTTAGTACTTTAGGAACTTGGAAGTCACCATGCTTTTTATATTGCTTTTAGAAAGCATGCACTTTTTCTCAACACTATACATTTGAAATACCTGACAATAAAAAAAATGCTTGTTTTTCAGGCTTTTTCTATGGAAAAGTTCCGCTCTCTGCAGGACAAGCTTCTGCTGCTGGATGAAGCCGTTTCTGTTTATGATGGCAATGTCATCACTGCT[G/T]TGAGCTGCACATCACACTCAATAACCCTATATGGAAAGACTGCTCTGGCTTTACAATGACTCATATTAGTAGGAACAGTGTTTTATTTATGTTGCTTAATCACTGATTATGTACATTTTCCTCCTGCAGGTCTTGATATATTTAAAAAAGTCATTAAGTAAAGGTAAGATGTTTTGCGATCATTAGTTGGCTTAGTGTGGATTAAATTTAAATAAATCTTTTTAATAGTTTTTGATAGTAAATACTATTATTAAATATAGTATATAATATGGGCGTCATGGTGGCACAGTGGATATAATGAGGGCCTCACAGCAAGAAAGTTGCTGGTTTGAGCCTCGGCTGGCTCAGTTGGCATTTCTGTTTGGAGTTTGCATGTTCTCCCCGTGTTTGCGTGGGTTTCCTTAAGGTGCTCCGGTTTCCCTAACAAGTCCAGAGACATGTGGTATAGGTGAATTGAGTAAGCTAAATTTGCCGTTGTGTATGTGTGTGAATGAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23664
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041451 Essential Splice Site 299 483 14 19
ENSDART00000135539 None None 212 None 7
Genomic Location (Zv9):
Chromosome 20 (position 18426757)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCAGGTGCACAGCATTTGATGTGTTATCTGTGTTTTTTTTTTTTCA[G/A]GCTAGTGACAAGAAGGCAGATACAGACATCTTTAAAAAGTTCCCCAGAAA
Long Flanking Sequence:
ATGTTTTTATAAGGCTACTTATAATTTTCTTTGATAGTATCCTGTAGTGCTTTTAAAATTGTTGTTCAGTACGATGTTTAGTTTGAATAAACTAATTTACTTTGCAAGTAAACTTGTAACTTCGTTTTTTTTTTCTTGGTTATTAAAAGTCGAAGATGTTATTCATAATTGACTTAAAAGCTTTCATTTTTAGTTGCTGTAACCTGCATAAACTAATATGTAGTGTACAATATTGTGTGGGTAAACAGACTTGTAATGTCAAATTTGACACATTTTAGCTCTGCATGGAAGCTTGATTTTTGTTAGTGGGACACGGTGCAGGGACATTTACACTTCCTGTGTGAGTAGGTTTGTTTTTTCTTTGTTAATACGAGACGCCGGATGTGTGAAGAAGCCCTAAATACATGAGAAAATGCCTCCCTGAAGAGAATATTGTTGCTGAGGGTTTATCACAGCAGGTGCACAGCATTTGATGTGTTATCTGTGTTTTTTTTTTTTCA[G/A]GCTAGTGACAAGAAGGCAGATACAGACATCTTTAAAAAGTTCCCCAGAAAAGCGTCCATCCTTAATATGCCGATCATCACCACTCTGTATTACTCCTGCTTCTACCATTACGGAGAGCCAGAGGTACAAGCGCATGATTCACTACTGCGATATGATGATGGATTATTTGCTGAATGTGTTACATTACATACAGTATTAAAATACAATATAATCTTACTCTGTAAGTACACTACACTGAATTCTTCAGAAGTCATTACTTTGTTTTGCTGTTTAACAAACATTTAATTTATGATAATTAACAATTAATATAATTAATATTTAATTTAGGGATGCATGATATATCGGAGGCCATATCGTTATCGGCCGATATATGCTATTTTTAAGATTATCGTTATCGATCCGATGTCTAAATTAGGCCGATATCTTTAAGCCGATAAATTACGTAATTGTTGCAGCGCACGCGTGGGCGGAACATGTTCAGACTTGTTCATGGATCTCTC
Associated Phenotype:
Not determined