Busch Lab

ZMP

ftr56

Ensembl ID:
ENSDARG00000030954
ZFIN ID:
ZDB-GENE-030131-2801
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXS0]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa8856 Nonsense Mutation detected in F1 DNA Not yet available
sa23480 Nonsense Available for shipment Available now
sa8740 Nonsense Mutation detected in F1 DNA Not yet available
sa9701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 77 561 1 6
Genomic Location (Zv9):
Chromosome 19 (position 13026402)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12484748
GRCz11 19 12404276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCCAAGACCTGCTTTAAATAAAAACACCATGCTGGCTGAAGTGGTGRAG[C/T]AACTGAAGAAGWCWRAACATCACACTSCTGCTGTTCCTGCTGGAGATGGA
Long Flanking Sequence:
ACAATGTACATAGAGAGGTATTCATCAGTGCAAATCATGTTTGCATATAAACAGCTTCTTACAAAGACTTTATCCATATTTGCTATAATAGCATGTGCAACTGTGTGTTTCACTATACTCCCCTCTAGTGGACCTCGAGGAAGTTTGAGTGCATTTTCTATGGTTACTCCCGTTTTGCTCACGCCTATAAATCTCAGAACCAGGAAATCACATCTACACTTCTGGGAAAACAAAACTTAAGTGCGGATTATTTGTGTTGTGTCTGCGGTAAAATGGCTGAATCCAGGTTTTCTCAGGAGCAGTTCAGCTGTCCAGTGTGTTTGGAGCTCTTGAAGAATCCAGTGGCCATTCCATGTGGACACAGTTACTGTATGAGCTGCATTACCGACTACTGGCATCACGAGGATGAGAAGAGAGTTTATAGCTGCCCTCAGTGCAGACAGACCTTCAGTCCAAGACCTGCTTTAAATAAAAACACCATGCTGGCTGAAGTGGTGGAG[C/T]AACTGAAGAAGACAAAACATCACACTGCTGCTGTTCCTGCTGGAGATGGAGACGTGGAGTGTGACAGCTGTACTGGAAGAAAACACAAAGCCATCAAGTCCTGTCTGGTGTGTCTGAACTCTTACTGTCAAAATCATCTTGAACAACATGAGAATCTCTTCAAAGGTAAAAGACACAACCTAATAGACGCTACTGGACGGCTTCAGGAGATGATCTGCCGTAAACATGATAAACTCCTAGAAATTTACTGCCGTACAGACCAGAGGTGTATTTGTATGCTCTGTATGGTGGATGAACACAAAGATCATGAAACTGTATCAACTTCAGCAGAGAGGACAGAGAAACAGGTATGGACTGAAACACTTTCATTTTCAATGAAAAGACAAACACAAATGCCACATACTTTCAGTTTCACTTTATTTCCATGTATTCTCATACAGAAACAATTAGGAGAGATACAGAGAAAATTCCAGCAGCAAATCCAGAAAAGAGAGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23480
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 125 561 1 6
Genomic Location (Zv9):
Chromosome 19 (position 13026258)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12484604
GRCz11 19 12404132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGTCCTGTCTGGTGTGTCTGAACTCTTACTGTCAAAATCATCTTGAA[C/T]AACATGAGAATCTCTTCAAAGGTAAAAGACACAACCTAATAGACGCTACT
Long Flanking Sequence:
TTGAGTGCATTTTCTATGGTTACTCCCGTTTTGCTCACGCCTATAAATCTCAGAACCAGGAAATCACATCTACACTTCTGGGAAAACAAAACTTAAGTGCGGATTATTTGTGTTGTGTCTGCGGTAAAATGGCTGAATCCAGGTTTTCTCAGGAGCAGTTCAGCTGTCCAGTGTGTTTGGAGCTCTTGAAGAATCCAGTGGCCATTCCATGTGGACACAGTTACTGTATGAGCTGCATTACCGACTACTGGCATCACGAGGATGAGAAGAGAGTTTATAGCTGCCCTCAGTGCAGACAGACCTTCAGTCCAAGACCTGCTTTAAATAAAAACACCATGCTGGCTGAAGTGGTGGAGCAACTGAAGAAGACAAAACATCACACTGCTGCTGTTCCTGCTGGAGATGGAGACGTGGAGTGTGACAGCTGTACTGGAAGAAAACACAAAGCCATCAAGTCCTGTCTGGTGTGTCTGAACTCTTACTGTCAAAATCATCTTGAA[C/T]AACATGAGAATCTCTTCAAAGGTAAAAGACACAACCTAATAGACGCTACTGGACGGCTTCAGGAGATGATCTGCCGTAAACATGATAAACTCCTAGAAATTTACTGCCGTACAGACCAGAGGTGTATTTGTATGCTCTGTATGGTGGATGAACACAAAGATCATGAAACTGTATCAACTTCAGCAGAGAGGACAGAGAAACAGGTATGGACTGAAACACTTTCATTTTCAATGAAAAGACAAACACAAATGCCACATACTTTCAGTTTCACTTTATTTCCATGTATTCTCATACAGAAACAATTAGGAGAGATACAGAGAAAATTCCAGCAGCAAATCCAGAAAAGAGAGAGGAAGCTTCAAGAGCTAAATGAAGCTGTGAAGATTCATGAGGTAAAATGCAAGAAAAAAGTAGCACTGATTTATATAGGTTTATGTATGTGTTGGGGGGGGTACTTACAATATAAAAAAAGTATTCATGCTGTTGGTGGATCAACTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4069
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 421 561 6 6
Genomic Location (Zv9):
Chromosome 19 (position 13021581)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12479927
GRCz11 19 12399455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTATCCTGATCATTTAGACAGATTTGATCAGTGTCGTCAGGTGCTGTGC[A/T]GAGAGAGTGTTTGTGGACGCTGCTACTGGGAGGTGGAGTGGAGTGGGAAT
Long Flanking Sequence:
AAATGTTGTTTCAGTTTGTTCATTTTTATAGGTTGAATATAAAATTGAGCAAAATAAATCACAACGTTTGATCCTAGTAAACACGGTATAACAACAGTGATTATACAGTAGATAACAGCTACTGTAAATTATGTCAAATCAGTTTTGTATTGTGTTGAAATAAAATTTGTAAACGAATCAAAATCCCCAGTGACTAAATATGCTTAATGTGTTAAATCTGTAATAATGTTAAATCCACTTACACATTTAAAGTGAAAAAAAATTAAACTGATTCATAAATGATAACGATTTAATTGTATTTGTGCCTTGTTAATGCATATCCAGCAAAAGGTTTTACTTTGTTTTTTTTTCTATTAGATTTCTGTCATTTCTCCCTGGATCCAAACACAGCTCATCAATGTCTCTGTCTGTCTGAGAGGAGCAGAGTAGTGACCTTATCTAGCAGACAGAATTATCCTGATCATTTAGACAGATTTGATCAGTGTCGTCAGGTGCTGTGC[A/T]GAGAGAGTGTTTGTGGACGCTGCTACTGGGAGGTGGAGTGGAGTGGGAATGTAGATATTTCAGTGTCATATAAAAGCATCAGCAGAAAGGGAGAGGGTGACGTTCAGTGTAGATTTGGATGTAATGATCAGTCCTGGAGTTTGTCTTGCTCCCGCTCCAGTTGTTCATTCAGACACAATGACATAAAGACTGATCTCGCTGTAGTGCCCGGCAATAGAATAGGAGTGTATGTGGATCACAGTGCAGGAATTCTGTCCTTCTACAGTGTTTCTGACACAATGACCCTCATCCACAGAGTCCACACCAGATTCACTCAGCCCCTCTATCCTGGCTTTAGATTTTTACATGTATTTGTTGGTATTTTAAAACAAGTTTTAGATAATTTTTCAGGTGAAACTGCAAGAGTTAAACTGTGTGACAGATAGATGGTCAAAGTGATTATTTCTTCAATACAGTAATTCGGCTAATATAATAAATTGTATTTTAATTCTTAATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 444 561 6 6
Genomic Location (Zv9):
Chromosome 19 (position 13021510)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12479856
GRCz11 19 12399384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTACTGGGAGGTGGAGTGGAGTGGGAATGNNNTAGATATTTCAGTGTCATA[T/G]WAAAGCATCARCAGAAAGGGAGAGGSTGACGTTCAGTGTAGATTTRGATG
Long Flanking Sequence:
TCCTAGTAAACACGGTATAACAACAGTGATTATACAGTAGATAACAGCTACTGTAAATTATGTCAAATCAGTTTTGTATTGTGTTGAAATAAAATTTGTAAACGAATCAAAATCCCCAGTGACTAAATATGCTTAATGTGTTAAATCTGTAATAATGTTAAATCCACTTACACATTTAAAGTGAAAAAAAATTAAACTGATTCATAAATGATAACGATTTAATTGTATTTGTGCCTTGTTAATGCATATCCAGCAAAAGGTTTTACTTTGTTTTTTTTTCTATTAGATTTCTGTCATTTCTCCCTGGATCCAAACACAGCTCATCAATGTCTCTGTCTGTCTGAGAGGAGCAGAGTAGTGACCTTATCTAGCAGACAGAATTATCCTGATCATTTAGACAGATTTGATCAGTGTCGTCAGGTGCTGTGCAGAGAGAGTGTTTGTGGACGCTGCTACTGGGAGGTGGAGTGGAGTGGGAATGTAGATATTTCAGTGTCATA[T/G]AAAAGCATCAGCAGAAAGGGAGAGGGTGACGTTCAGTGTAGATTTGGATGTAATGATCAGTCCTGGAGTTTGTCTTGCTCCCGCTCCAGTTGTTCATTCAGACACAATGACATAAAGACTGATCTCGCTGTAGTGCCCGGCAATAGAATAGGAGTGTATGTGGATCACAGTGCAGGAATTCTGTCCTTCTACAGTGTTTCTGACACAATGACCCTCATCCACAGAGTCCACACCAGATTCACTCAGCCCCTCTATCCTGGCTTTAGATTTTTACATGTATTTGTTGGTATTTTAAAACAAGTTTTAGATAATTTTTCAGGTGAAACTGCAAGAGTTAAACTGTGTGACAGATAGATGGTCAAAGTGATTATTTCTTCAATACAGTAATTCGGCTAATATAATAAATTGTATTTTAATTCTTAATGCAAAACATTTGATTGGATCCGATACAGATGAATGCATTTGAGAAGTTTGTGAGGTAACTATTTTCTCATTTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9701
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 445 561 6 6
Genomic Location (Zv9):
Chromosome 19 (position 13021509)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12479855
GRCz11 19 12399383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTACTGGGAGGTGGAGTGGAGTGGGAATGNNNTAGATATTTCAGTGTCATAK[A/T]AAAGCATCARCAGAAAGGGAGAGGSTGACGTTCAGTGTAGATTTRGATGT
Long Flanking Sequence:
CCTAGTAAACACGGTATAACAACAGTGATTATACAGTAGATAACAGCTACTGTAAATTATGTCAAATCAGTTTTGTATTGTGTTGAAATAAAATTTGTAAACGAATCAAAATCCCCAGTGACTAAATATGCTTAATGTGTTAAATCTGTAATAATGTTAAATCCACTTACACATTTAAAGTGAAAAAAAATTAAACTGATTCATAAATGATAACGATTTAATTGTATTTGTGCCTTGTTAATGCATATCCAGCAAAAGGTTTTACTTTGTTTTTTTTTCTATTAGATTTCTGTCATTTCTCCCTGGATCCAAACACAGCTCATCAATGTCTCTGTCTGTCTGAGAGGAGCAGAGTAGTGACCTTATCTAGCAGACAGAATTATCCTGATCATTTAGACAGATTTGATCAGTGTCGTCAGGTGCTGTGCAGAGAGAGTGTTTGTGGACGCTGCTACTGGGAGGTGGAGTGGAGTGGGAATGTAGATATTTCAGTGTCATAT[A/T]AAAGCATCAGCAGAAAGGGAGAGGGTGACGTTCAGTGTAGATTTGGATGTAATGATCAGTCCTGGAGTTTGTCTTGCTCCCGCTCCAGTTGTTCATTCAGACACAATGACATAAAGACTGATCTCGCTGTAGTGCCCGGCAATAGAATAGGAGTGTATGTGGATCACAGTGCAGGAATTCTGTCCTTCTACAGTGTTTCTGACACAATGACCCTCATCCACAGAGTCCACACCAGATTCACTCAGCCCCTCTATCCTGGCTTTAGATTTTTACATGTATTTGTTGGTATTTTAAAACAAGTTTTAGATAATTTTTCAGGTGAAACTGCAAGAGTTAAACTGTGTGACAGATAGATGGTCAAAGTGATTATTTCTTCAATACAGTAATTCGGCTAATATAATAAATTGTATTTTAATTCTTAATGCAAAACATTTGATTGGATCCGATACAGATGAATGCATTTGAGAAGTTTGTGAGGTAACTATTTTCTCATTTGATCA
Associated Phenotype:
Not determined