Busch Lab

ZMP

si:busm1-122b7.1

Ensembl ID:
ENSDARG00000030933
ZFIN ID:
ZDB-GENE-040724-45
Description:
Si:busm1-122b7.1 protein [Source:UniProtKB/TrEMBL;Acc:A8E5P2]
Human Orthologue:
KSR1
Human Description:
kinase suppressor of ras 1 [Source:HGNC Symbol;Acc:6465]
Mouse Orthologue:
Ksr1
Mouse Description:
kinase suppressor of ras 1 Gene [Source:MGI Symbol;Acc:MGI:105051]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42576 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17165 Essential Splice Site Available for shipment Available now
sa39058 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28483
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048103 Nonsense 333 982 5 20
Genomic Location (Zv9):
Chromosome 15 (position 30387751)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31209458
GRCz11 15 31090199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAAATGCAGTGTTTTTTTCCTCTGACCTGCAGGAGTGGGAAGAAGAAC[A/T]AGCCTCTCCTAAACGTGCAGGTGAACGGTGGAGCAAACGGATGGGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42576
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048103 Essential Splice Site 560 982 11 20
Genomic Location (Zv9):
Chromosome 15 (position 30381902)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31203609
GRCz11 15 31084350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTAGCTGCCTGCTACTTTCAGCATAGACAACAGTTTGTCTTCCCTGG[T/C]AAGTTAAGAATTCTCCCCACAACAAAACTCTGTGATTTTTCTCTTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17165
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048103 Essential Splice Site 801 982 16 20
Genomic Location (Zv9):
Chromosome 15 (position 30373002)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31194709
GRCz11 15 31075450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACAGATTTTGGCCTKTTTGGGATGTCTGGAGTGGTTCAAGAGGACAGG[T/C]ACAGAGTCAGTCTATTATAATAAATCAATTAACCCTATTATGGAGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39058
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048103 Nonsense 849 982 18 20
Genomic Location (Zv9):
Chromosome 15 (position 30372558)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31194265
GRCz11 15 31075006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTTGGTTATTTGACTGTAAATGTGTCTGTTTTAGCACTATCTGGTA[T/G]GAACTCCAGGCCAAAGCCTGGCCAATCATCAACCAGCCGACTCAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28482
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048103 Nonsense 856 982 18 20
Genomic Location (Zv9):
Chromosome 15 (position 30372537)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31194244
GRCz11 15 31074985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGTGTCTGTTTTAGCACTATCTGGTATGAACTCCAGGCCAAAGCCTG[G/A]CCAATCATCAACCAGCCGACTCAAGTGTTGATCTATCAGCTGGGAAGTGG
Associated Phenotype:
Not determined