Busch Lab

ZMP

foxq1l

Ensembl ID:
ENSDARG00000030896
ZFIN ID:
ZDB-GENE-070424-74
Description:
Zgc:162905 protein [Source:UniProtKB/TrEMBL;Acc:Q566W3]
Human Orthologue:
FOXQ1
Human Description:
forkhead box Q1 [Source:HGNC Symbol;Acc:20951]
Mouse Orthologue:
Foxq1
Mouse Description:
forkhead box Q1 Gene [Source:MGI Symbol;Acc:MGI:1298228]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32819 Nonsense Mutation detected in F1 DNA Not yet available
sa9415 Nonsense Available for shipment Available now
sa18716 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 34 310 1 1
Genomic Location (Zv9):
Chromosome 2 (position 903396)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 849688
GRCz11 2 722054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCTGAAGCTCTGCCAATGAAACTGGAGGTTTTCTGCGGGAGTCACTA[C/A]GACTCCAAGCCTGCGGAGTTGTGCAGCGATGCTGAGGGGAGCATCCCATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8070
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 227 310 1 1
Genomic Location (Zv9):
Chromosome 2 (position 902819)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 849111
GRCz11 2 721477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCGAGCGGAAAGTTCACCAGTTCTTTCGCCATTGAGAGCATCCTCAGT[C/T]RACCCTTCAGAAGGGAGGACCGCCCCGTGCTCAGCCCTGACACCTGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 270 310 1 1
ENSDART00000045770 Nonsense 270 310 1 1
Genomic Location (Zv9):
Chromosome 2 (position 902690)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 848982
GRCz11 2 721348
KASP Assay ID:
2259-1433.1 (used for ordering genotyping assays)
KASP Sequence:
TCATGCTTCGATCCTATGGTGCCCTRGAGGACCCTTCCRTGAGCCGCCGA[C/T]AGCGCGACTTTTTCGCATTCCAGCTGCCRCCTGAGTGCCTCTCAATCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18716
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 270 310 1 1
ENSDART00000045770 Nonsense 270 310 1 1
Genomic Location (Zv9):
Chromosome 2 (position 902690)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 848982
GRCz11 2 721348
KASP Assay ID:
2259-1433.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGCTTCGATCCTATGGTGCCCTGGAGGACCCTTCCATGAGCCGCCGA[C/T]AGCGCGACTTTTTCGCATTCCAGCTGCCGCCTGAGTGCCTCTCAATCCCG
Associated Phenotype:
Not determined