Busch Lab

ZMP

otof

Ensembl ID:
ENSDARG00000030832
ZFIN ID:
ZDB-GENE-030131-7778
Description:
Otoferlin [Source:UniProtKB/Swiss-Prot;Acc:Q5SPC5]
Human Orthologue:
OTOF
Human Description:
otoferlin [Source:HGNC Symbol;Acc:8515]
Mouse Orthologue:
Otof
Mouse Description:
otoferlin Gene [Source:MGI Symbol;Acc:MGI:1891247]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa17391 Nonsense Available for shipment Available now
sa23735 Essential Splice Site Available for shipment Available now
sa23736 Nonsense Available for shipment Available now
sa18571 Nonsense Available for shipment Available now
sa43473 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4097
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 None None 1837 None 43
ENSDART00000136255 Essential Splice Site 27 1992 1 46
Genomic Location (Zv9):
Chromosome 20 (position 31102526)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31173739
GRCz11 20 31076618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGGAGCTCCGTGGGAAGGGGGACCGAATCGCTAAAGTCACTTTCAGAGG[T/G]AAAGAGCGATACNTTTTTTCATTTACAGTGAACGGGTGTGTGCTCGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17391
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 38 1837 2 43
ENSDART00000136255 Nonsense 212 1992 7 46
Genomic Location (Zv9):
Chromosome 20 (position 31189503)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31260716
GRCz11 20 31163595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCTTGTGTGCAGATGATGCKGCYATTCTGGATGCAGAAGATCTGGAT[C/T]GAAAAGCCATGCGTCTAGGCGGCATTCTTGACCCTGATACAATCTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23735
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Essential Splice Site 151 1837 5 43
ENSDART00000136255 Essential Splice Site 325 1992 10 46
Genomic Location (Zv9):
Chromosome 20 (position 31195750)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31266963
GRCz11 20 31169842
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCACGTGCCTCCAGACGTCATGTTTGACAAAATTATAAAGATTTCAG[T/C]GAGTAGATAAAGCCACGCATCATACACTTTTACAAACCTTTAATCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23736
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 589 1837 14 43
ENSDART00000136255 Nonsense 763 1992 19 46
Genomic Location (Zv9):
Chromosome 20 (position 31206597)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31277810
GRCz11 20 31180689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGGTCTGAATGATGTTCAAGAGATCATAAAAACAGAGAAGGCATA[T/A]CCAGAACGAAGACTAAGAGGTGTATTAGAAGAACTTAGCACAAGCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18571
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 592 1837 14 43
ENSDART00000136255 Nonsense 766 1992 19 46
Genomic Location (Zv9):
Chromosome 20 (position 31206604)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31277817
GRCz11 20 31180696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTGAATGATGTTCAAGAGATCAYAAAAACAGAGAAGGCATATCCAGAA[C/T]GAAGACTWAGAGGTGTATTAGAAGAACTTAGCACAAGCTGCAGGTGACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29388
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 898 1837 21 43
ENSDART00000136255 Nonsense 1072 1992 26 46
Genomic Location (Zv9):
Chromosome 20 (position 31211456)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31282669
GRCz11 20 31185548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGCCGAACATTTGCAAAACCACTTACTAAGATGGTTGATGAACACTA[C/A]GGCCCACCGCGGTTTCCTCCCCAGCTCGAGTATTATCAGATCTACCGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3087
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 1104 1837 25 43
ENSDART00000136255 Splice Site None 1992 None 46
Genomic Location (Zv9):
Chromosome 20 (position 31214766)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31285979
GRCz11 20 31188858
KASP Assay ID:
554-3352.1 (used for ordering genotyping assays)
KASP Sequence:
CTCASCAATGGGACGTCTCATTCCCGCCCCCAATCCCGTCCTGTTTCTTA[T/A]CCCTCAGGTGACATTGTGGTCAACATGAGCCCTGAACCTAACATTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43473
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 1296 1837 33 43
ENSDART00000136255 Nonsense 1453 1992 36 46
Genomic Location (Zv9):
Chromosome 20 (position 31218200)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31289413
GRCz11 20 31192292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATGATTTTGATATTTTGTCTTCTTATGAACCAGGGCTCCCTCTG[T/A]ATGTATAAACTACCACTGTCTGAGGAGATCACCAGAGAGGCAGGATTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4912
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 1733 1837 41 43
ENSDART00000136255 Nonsense 1890 1992 44 46
Genomic Location (Zv9):
Chromosome 20 (position 31232404)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31303617
GRCz11 20 31206496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCCATCTTCAAACAAAAGAGAGTCAAGGGCTGGTGGCCATTTGTGGCC[C/T]AAAATGAGAATGATRAATTTGAGCTAACGGTGAGTTTATRGAATGTYGTT
Associated Phenotype:
Not determined