Busch Lab

ZMP

si:dkey-246k9.1

Ensembl ID:
ENSDARG00000030743
ZFIN IDs:
ZDB-GENE-040801-81, ZDB-GENE-040801-81, ZDB-GENE-041210-281
Description:
hypothetical protein LOC445168 [Source:RefSeq peptide;Acc:NP_001003562]
Human Orthologue:
SPTLC3
Human Description:
serine palmitoyltransferase, long chain base subunit 3 [Source:HGNC Symbol;Acc:16253]
Mouse Orthologue:
Sptlc3
Mouse Description:
serine palmitoyltransferase, long chain base subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2444678]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35545 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047552 Nonsense 117 553 3 12
ENSDART00000134573 Nonsense 117 204 4 5
Genomic Location (Zv9):
Chromosome 13 (position 35076754)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34729787
GRCz11 13 34855793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTACAGGACTTTGTTCCCCTTTACCAAGATTTTGAAAACTTCTACAAA[C/T]GAAATCTGTACATGAGAGTCAGGGACAACTGGAATCGGCCCATATGCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28161
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047552 Essential Splice Site 516 553 11 12
ENSDART00000134573 None None 204 None 5
Genomic Location (Zv9):
Chromosome 13 (position 35030291)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34683324
GRCz11 13 34809330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTCGATTCTGTGTGTCTGCTGCTCACACCAGAGACATGCTCAACAAG[G/A]TAATAAGCACCTTATATCTCAAACTAGGCCTGTCAGGATATCTGTTTTTT
Associated Phenotype:
Not determined