Busch Lab

ZMP

zgc:110191

Ensembl ID:
ENSDARG00000030632
ZFIN ID:
ZDB-GENE-050522-184
Description:
hypothetical protein LOC553593 [Source:RefSeq peptide;Acc:NP_001018406]
Human Orthologue:
CCDC3
Human Description:
coiled-coil domain containing 3 [Source:HGNC Symbol;Acc:23813]
Mouse Orthologue:
Ccdc3
Mouse Description:
coiled-coil domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1921436]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14321
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042221 Nonsense 100 271 1 3
Genomic Location (Zv9):
Chromosome 11 (position 4237348)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 4155852
GRCz11 11 4175239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCTGGAGGTGCCCGCCGGATCCAGGTTCAACGTCAGCGGGCTGGGGTA[T/A]TTCCCCTGCTACTCATACAGCGTCATGGAGAATAACTCCTACTATTTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27718
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042221 Essential Splice Site 119 271 1 3
Genomic Location (Zv9):
Chromosome 11 (position 4237291)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 4155795
GRCz11 11 4175182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTACTCATACAGCGTCATGGAGAATAACTCCTACTATTTCTTTCTGAG[G/A]TAAGATTCAAAGGTCGCATGAAATTATAATAAAGTTTAAGATGTTAGTAT
Associated Phenotype:
Not determined