Busch Lab

ZMP

th

Ensembl ID:
ENSDARG00000030621
ZFIN ID:
ZDB-GENE-990621-5
Description:
tyrosine 3-monooxygenase [Source:RefSeq peptide;Acc:NP_571224]
Human Orthologue:
TH
Human Description:
tyrosine hydroxylase [Source:HGNC Symbol;Acc:11782]
Mouse Orthologue:
Th
Mouse Description:
tyrosine hydroxylase Gene [Source:MGI Symbol;Acc:MGI:98735]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38085 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1635 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa38085
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Essential Splice Site 97 489 3 13
ENSDART00000044624 Essential Splice Site 4 110 2 12
Genomic Location (Zv9):
Chromosome 25 (position 24793346)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23972459
GRCz11 25 24070007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGCACTATTTTCATAATATTTATTTTATTATATCAATTGAACACCAC[A/T]GACATTTGAGGCCAAAATCCACCATCTTGAAACCAGACCCAGCCGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1635
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Essential Splice Site 360 489 10 13
ENSDART00000044624 Essential Splice Site None 110 9 12
Genomic Location (Zv9):
Chromosome 25 (position 24783281)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23962394
GRCz11 25 24059942
KASP Assay ID:
554-1575.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGGCATCTCTTGGAGCTTCTGATGAAGATATTGAGAAGCTATCGACAG[T/A]AAGTATAAATCATCTCAAAGCTTATGAAACTCAGTATTTTAYATGTAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4299
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Nonsense 412 489 12 13
ENSDART00000044624 None None 110 11 12
Genomic Location (Zv9):
Chromosome 25 (position 24781144)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23960257
GRCz11 25 24057805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCAGATGAGCCAGAGAGACGAGAATTTGACCCAGATATTGTTGCTGTT[C/T]AGCCATACCAAGACCAGACTTACCAACCTGTCTATTTTGTGTCAGAAAGC
Associated Phenotype:
Not determined