Busch Lab

ZMP

syt1a

Ensembl ID:
ENSDARG00000030614
ZFIN ID:
ZDB-GENE-040718-165
Description:
synaptotagmin Ia [Source:RefSeq peptide;Acc:NP_001002463]
Human Orthologue:
SYT1
Human Description:
synaptotagmin I [Source:HGNC Symbol;Acc:11509]
Mouse Orthologue:
Syt1
Mouse Description:
synaptotagmin I Gene [Source:MGI Symbol;Acc:MGI:99667]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2183
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041861 Essential Splice Site 351 419 9 9
ENSDART00000066896 None None 271 None 7
Genomic Location (Zv9):
Chromosome 4 (position 20247158)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21590493
GRCz11 4 21311468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACCAACTGAAAGGCCCAAATGTTGTGTTTTGTCTCTAATTTCTTTTAC[A/G]GAAAGTTCAAGTTGTTATAACTGTTCTGGACTATGACAAGATTGGCAAGA
Long Flanking Sequence:
TGATTTTTTTATTTAGTTAAAAGAAAGTATTAGTTTCATTCAGCAAGAATACATTTTATTTTCAAAGGTGAATATATTTATACAGCACAAATATATTGTATATATCAGAATGCTGTGATTGACAATTCAGAATCGAGCAATTTACAAGCCACCCGTCGAAACATTTTCTCTCTGAGCACAAACGAGTTACTTTGCATACCACTTGTTGTGTGTATCGCCTCTTCTCGTCGGATCGCTGAATGCCTCCTCAATTGTAAGTCACTTTGGAATGTAAATGCAGATGAGAGAGCCATTTATAATTGAAATGAATAGTAGTGTACACATAAATGAAATCATGCCATTGATGATATGCGTTTTTTGAAACGCAAACTTTAGTCATTTCTATTAAAAGATGTTTGTACACATTTTCTGTTGATCACAGGAATTAATGTTTGATCAAACTGCATGTTGGAACCAACTGAAAGGCCCAAATGTTGTGTTTTGTCTCTAATTTCTTTTAC[A/G]GAAAGTTCAAGTTGTTATAACTGTTCTGGACTATGACAAGATTGGCAAGAACGATGCCATCGGCAAGGTGTTTGTGGGCTTGAACAGCACAGGCACCGAGCTCCGTCACTGGTCAGACATGCTGGCCAACCCGAGGAGACCCATCGCGCAGTGGCACGTGCTGAAACCCGAGGAGGAAGTGGATGCCCTGCTGGCAGCTCAGAAAAAATAGAGCAGTCCTCGGCCAAACCCTTGCCCCCCCTTCCCACAGTCCCACCCGTGTAGTGCTCTTTACCCAGTGCGTGTAAATACCTCAGTGATATAAGGATCCATGCACCCTCACTCCTAATTTGGTGTCTAAGAAAACCCGCCTTCTCGGACGACCCTTGAGATGTTGTGTTGTTATGTCGTTTTCGACCCTCGGCCCTTCCTTCCTTCCTTCTGTCGATAAACTTTTCTCTGTCCTTTATCGTTTCGCCTTCATCCACGACCTTAAAATCCCCGACCAAACGCCCCCTTCT
Associated Phenotype:
Not determined