Busch Lab

ZMP

ARHGEF12 (1 of 2)

Ensembl ID:
ENSDARG00000030532
Description:
Rho guanine nucleotide exchange factor (GEF) 12 [Source:HGNC Symbol;Acc:14193]
Human Orthologue:
ARHGEF12
Human Description:
Rho guanine nucleotide exchange factor (GEF) 12 [Source:HGNC Symbol;Acc:14193]
Mouse Orthologue:
Arhgef12
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6375 Nonsense Mutation detected in F1 DNA Not yet available
sa10278 Nonsense Available for shipment Available now
sa17338 Essential Splice Site Available for shipment Available now
sa32031 Essential Splice Site Available for shipment Available now
sa35876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6375
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Nonsense 506 1357 18 39
Genomic Location (Zv9):
Chromosome 15 (position 21469728)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22572354
GRCz11 15 22508086
KASP Assay ID:
554-5466.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAGTTTGGTCTCTTCCAGCTCCACTATACAGTATGTGATCTTCATGTA[C/A]ATGAAGCATCTGGGAGTTCGGGCGAAAGARCARCGAAACCTGGAATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Nonsense 524 1357 18 39
Genomic Location (Zv9):
Chromosome 15 (position 21469780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22572406
GRCz11 15 22508138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGCATCTGGGAGTTCGGGCGAAAGARCARCGAAACCTGGAATCCAAA[C/T]GAGTTCGAATTAATTTCCTTCCTTCCAAACTAAGGGTATGTGCCATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Essential Splice Site 698 1357 22 39
ENSDART00000040542 Essential Splice Site 698 1357 22 39
Genomic Location (Zv9):
Chromosome 15 (position 21475284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22577910
GRCz11 15 22513642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTTTTTTTAGACCTCCTGATGTGGGCACACCTAAACCGAGCAGAAG[G/A]TAATGGTCACTGCTTCTGTCAATCACTCACAKCACTCTAAATACACCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Essential Splice Site 698 1357 22 39
ENSDART00000040542 Essential Splice Site 698 1357 22 39
Genomic Location (Zv9):
Chromosome 15 (position 21475284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22577910
GRCz11 15 22513642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTTTAGACCTCCTGATGTGGGCACACCTAAACCGAGCAGAAG[G/T]TAATGGTCACTGCTTCTGTCAATCACTCACATCACTCTAAATACACCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35876
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Nonsense 828 1357 26 39
Genomic Location (Zv9):
Chromosome 15 (position 21478427)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22581053
GRCz11 15 22516785
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTCACCCATGTATCCTCTGGCTTGTTGTTTTCTAGTTCAGCAGTGGA[G/T]AGGAGGAGAAGATCAAGCAAGCAGTGGGCACTTTCTGCAGTAACCAGCCC
Associated Phenotype:
Not determined