Busch Lab

ZMP

il6st

Ensembl ID:
ENSDARG00000030498
ZFIN ID:
ZDB-GENE-080104-6
Description:
interleukin-6 receptor subunit beta [Source:RefSeq peptide;Acc:NP_001106976]
Human Orthologue:
IL6ST
Human Description:
interleukin 6 signal transducer (gp130, oncostatin M receptor) [Source:HGNC Symbol;Acc:6021]
Mouse Orthologue:
Il6st
Mouse Description:
interleukin 6 signal transducer Gene [Source:MGI Symbol;Acc:MGI:96560]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa34843 Nonsense Mutation detected in F1 DNA Not yet available
sa21663 Nonsense Available for shipment Available now
sa45394 Nonsense Mutation detected in F1 DNA Not yet available
sa1462 Nonsense Available for shipment Available now
sa21662 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 183 866 4 15
ENSDART00000122516 Nonsense 183 859 4 15
ENSDART00000146913 None None 306 None 6
Genomic Location (Zv9):
Chromosome 10 (position 7800473)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5809523
GRCz11 10 5810742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTTTTTTCGTTCTTTAGACAAGATTTATATAACAGCACCTGTAAA[C/T]AGAGTCTTGCAAGAAGTTGCACCGTCAACCTGAGCACTTATCCTGTTCAT
Long Flanking Sequence:
AACAGCGGTGTAGACAGACACGCTTGTATATGGATTTGTATTTATTTATCTTGAGGCAAAAAAATAAAATAAAAAAACTTTATCTTTCCTTCTTGCAGCATGTCTCAATTCTTCTTTAGTGGGAAATAATGACTGTATGATAGTGCTAGAAATGTCCTGATTATTTATGCATTGCTAGGGATTTGAACTTTGTTATGCTTATAATAATTTTTCTGTTTATTTCCTCTAGACCCTCCGATGAAACCAAAGAATCTGACATGCATTGCTTTGCAAAGGAAGAAGGATATTTCTCCTGACCTAAATTGTTATTGGGAACCAGGATTGAGAGACCCACTGCTTGCCACCAATTATACTCTTTATGCCCAAGTAGGGTATGTATTAGAGTAGTCTTGTTCTAGATTACAGCATAGTAGATTCAGTATCTTTAATAGCTTCAGAACTAAATGTTTATTGTCTTTTTTTCGTTCTTTAGACAAGATTTATATAACAGCACCTGTAAA[C/T]AGAGTCTTGCAAGAAGTTGCACCGTCAACCTGAGCACTTATCCTGTTCATATGACTTTGAAAGTCTGGGTTGAAGTGAAAAATTCACTGGGGTCAGAACGGTCAGACGAACACGAGTACGATTCCTTGAGTCTTGGTAAGATTTTTAGTTTGGCATTAGAAAAGGATGCATTTCACTATCTAAATGAAAATATACAAGCATACTTTTTTATCATAACATTTCATAACATTAATTGGTTTTGTACTTGTATTGCAGTGAAACCAAATCCACCAAATGTCGAAGTTAAAGTTGAAGAGGACTTCCCTACATCTTTTGTGGTTAAATGGGAGTATGACATTGAAGACACAACTATGCGATTCTCCAGTGCCATTAGATACTGCCAAGTAGGGTCAAGTGATTGGAAAAAGGTATTAAAAAAGCCACATTCTTTTTCTTAGCAAACAAACCAGTCTAAGCTGTAATGTTTTCTGTCTTGAATGCGTTTATTTAGCCCTCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21663
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 387 866 8 15
ENSDART00000122516 Nonsense 380 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location (Zv9):
Chromosome 10 (position 7793914)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5802964
GRCz11 10 5804183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTT[G/T]AAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAA
Long Flanking Sequence:
CAGCTGACGTCAGTGAAGGGTTTGCGTCTTTAATAAACTACGACAGTTTGCATTCAGTAAAAGTTAAGAATGATTAATAAATAAATATGAAACAGTCTCCTAAAAGTCACGTTGCGTCTTCAGTTTCGGGCTCAGGCGCGATTTGCACTCAAACTACAAGCGTACAGTGCCAAAGCCCAAGTGAACCGTGCTCTGGCACACCTCTTCCAACCGAGTTAGGGACGGCCAACTAAACCACGACTGAGCCTGATTCACACTTGTCAAACGAATCGTGAAACGCACCTGGGCACGGTTCGGATAGTATGTGTGCGCCCTTAAATATCAGTAATACTATTTGTGCTGGCTAGAAATCTCTCAAGTGTAAAAAAACAAGTGATCAAGTTAAATATGAATTGTTTTTAAATGATTATTATTATTCTTTCCCATTACAGCCTCCTGTGAAAGCTAATGGAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTT[G/T]AAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGCCACCAGAAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGGTACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGACCACGAAAACAAGTCACAAGTGTCACTTTTTGTTTCAAATTGAGATTTATATATTACTTGATAGCTGAATTAATAAGCTATTCATTGATACTATATATAGTGGTGTGATCTACAGTATACAGTTGAAGTCAGAATTATTAGCCCCCCTCTTAATTTTTTTCCCAATTTCTGTTTAACAGAGAGAAGATTTTTTTTCAACACATTTCTAAACATAATAGGTTTAATAACTCATTTGTAATTTTTCAATTCTTGATTTATTTTATTTTTGTCTTGAGATATTTTTCAAGACACTTCTATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45394
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 400 866 8 15
ENSDART00000122516 Nonsense 393 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location (Zv9):
Chromosome 10 (position 7793873)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5802923
GRCz11 10 5804142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTTTTGAAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTA[T/A]TCACTGGAAGTGCCACCAGAAGAAAATGCCAGTATTGAAATAACTGCATT
Long Flanking Sequence:
GACAGTTTGCATTCAGTAAAAGTTAAGAATGATTAATAAATAAATATGAAACAGTCTCCTAAAAGTCACGTTGCGTCTTCAGTTTCGGGCTCAGGCGCGATTTGCACTCAAACTACAAGCGTACAGTGCCAAAGCCCAAGTGAACCGTGCTCTGGCACACCTCTTCCAACCGAGTTAGGGACGGCCAACTAAACCACGACTGAGCCTGATTCACACTTGTCAAACGAATCGTGAAACGCACCTGGGCACGGTTCGGATAGTATGTGTGCGCCCTTAAATATCAGTAATACTATTTGTGCTGGCTAGAAATCTCTCAAGTGTAAAAAAACAAGTGATCAAGTTAAATATGAATTGTTTTTAAATGATTATTATTATTCTTTCCCATTACAGCCTCCTGTGAAAGCTAATGGAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTTGAAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTA[T/A]TCACTGGAAGTGCCACCAGAAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGGTACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGACCACGAAAACAAGTCACAAGTGTCACTTTTTGTTTCAAATTGAGATTTATATATTACTTGATAGCTGAATTAATAAGCTATTCATTGATACTATATATAGTGGTGTGATCTACAGTATACAGTTGAAGTCAGAATTATTAGCCCCCCTCTTAATTTTTTTCCCAATTTCTGTTTAACAGAGAGAAGATTTTTTTTCAACACATTTCTAAACATAATAGGTTTAATAACTCATTTGTAATTTTTCAATTCTTGATTTATTTTATTTTTGTCTTGAGATATTTTTCAAGACACTTCTATAAAGATTAAAGTGACATTTAAAGGGCTTAACTAGGTTAATTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1462
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 407 866 8 15
ENSDART00000122516 Nonsense 400 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location (Zv9):
Chromosome 10 (position 7793854)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5802904
GRCz11 10 5804123
KASP Assay ID:
554-1387.1 (used for ordering genotyping assays)
KASP Sequence:
TTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGCCACCA[G/T]AAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCT
Long Flanking Sequence:
AAGTTAAGAATGATTAATAAATAAATATGAAACAGTCTCCTAAAAGTCACGTTGCGTCTTCAGTTTCGGGCTCAGGCGCGATTTGCACTCAAACTACAAGCGTACAGTGCCAAAGCCCAAGTGAACCGTGCTCTGGCACACCTCTTCCAACCGAGTTAGGGACGGCCAACTAAACCACGACTGAGCCTGATTCACACTTGTCAAACGAATCGTGAAACGCACCTGGGCACGGTTCGGATAGTATGTGTGCGCCCTTAAATATCAGTAATACTATTTGTGCTGGCTAGAAATCTCTCAAGTGTAAAAAAACAAGTGATCAAGTTAAATATGAATTGTTTTTAAATGATTATTATTATTCTTTCCCATTACAGCCTCCTGTGAAAGCTAATGGAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTTGAAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGCCACCA[G/T]AAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGGTACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGACCACGAAAACAAGTCACAAGTGTCACTTTTTGTTTCAAATTGAGATTTATATATTACTTGATAGCTGAATTAATAAGCTATTCATTGATACTATATATAGTGGTGTGATCTACAGTATACAGTTGAAGTCAGAATTATTAGCCCCCCTCTTAATTTTTTTCCCAATTTCTGTTTAACAGAGAGAAGATTTTTTTTCAACACATTTCTAAACATAATAGGTTTAATAACTCATTTGTAATTTTTCAATTCTTGATTTATTTTATTTTTGTCTTGAGATATTTTTCAAGACACTTCTATAAAGATTAAAGTGACATTTAAAGGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGTTAGGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Essential Splice Site 436 866 8 15
ENSDART00000122516 Essential Splice Site 429 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location (Zv9):
Chromosome 10 (position 7793765)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5802815
GRCz11 10 5804034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGG[T/A]ACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGA
Long Flanking Sequence:
CAAACTACAAGCGTACAGTGCCAAAGCCCAAGTGAACCGTGCTCTGGCACACCTCTTCCAACCGAGTTAGGGACGGCCAACTAAACCACGACTGAGCCTGATTCACACTTGTCAAACGAATCGTGAAACGCACCTGGGCACGGTTCGGATAGTATGTGTGCGCCCTTAAATATCAGTAATACTATTTGTGCTGGCTAGAAATCTCTCAAGTGTAAAAAAACAAGTGATCAAGTTAAATATGAATTGTTTTTAAATGATTATTATTATTCTTTCCCATTACAGCCTCCTGTGAAAGCTAATGGAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTTGAAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGCCACCAGAAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGG[T/A]ACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGACCACGAAAACAAGTCACAAGTGTCACTTTTTGTTTCAAATTGAGATTTATATATTACTTGATAGCTGAATTAATAAGCTATTCATTGATACTATATATAGTGGTGTGATCTACAGTATACAGTTGAAGTCAGAATTATTAGCCCCCCTCTTAATTTTTTTCCCAATTTCTGTTTAACAGAGAGAAGATTTTTTTTCAACACATTTCTAAACATAATAGGTTTAATAACTCATTTGTAATTTTTCAATTCTTGATTTATTTTATTTTTGTCTTGAGATATTTTTCAAGACACTTCTATAAAGATTAAAGTGACATTTAAAGGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGTTAGGGTAAATAGGCAAGCTAGTGTATTACGATGGTTTGTTCTGTAGACTATCGGAAAAAAATATAGCTTAAAGGGGCTAATCATTTTGTCCCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7643
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 513 866 10 15
ENSDART00000122516 Nonsense 506 859 10 15
ENSDART00000146913 Nonsense 8 306 1 6
Genomic Location (Zv9):
Chromosome 10 (position 7791247)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5800297
GRCz11 10 5801516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCCCAAGGTAATTTAGCCAAATACAAGCAGTACAACRTATCAGTCTA[T/A]CCAATCTACAAGTTCTATTATGATGGTCRATGGCATTTCCAAGCAGGAAC
Long Flanking Sequence:
AAACCACCAACTGTTCTGGCATATGTTTTACACAGCGGATGATCTTCCAGCCAAAACCCAGTACTGGAAAACACCCATACACTCTAGCATTCACACACACTCATACATTATGGCCAATTTAATTTATTCAATTCATCTATACTGCATGTCTTTGCACTGTGGGGGAAACAGGAGCATCTGGAGGATACCCATGTGAACACTGGGAGAACGTGCAAACTGCACATAGAAGTGCCAACTGACCAAGCCGGCACTCGAACCAGCGACCTTCTTGCTGTGAGGCGACAGTGCTAACCACCGAGCCACCGTTTAGCTTAATAACACTAACTTATTTTTGGAGTTTATTTTAAAATGATTTCTGAAAGTTCACGTGTATGCTAAAGCTTCACTGCAATACATTACATTAAAAAGTAGGTGTGTTACATTTTTAATATTTAACAAACATCTTTCCTGCTCTCCCAAGGTAATTTAGCCAAATACAAGCAGTACAACATATCAGTCTA[T/A]CCAATCTACAAGTTCTATTATGATGGTCGATGGCATTTCCAAGCAGGAACACCAGTAACCAAGCCAGCCTACGTTCAGCAAGGAGGTATGTATGTCATATTCGGATTTCACTCCTTCAACGCTTCAGCTTTCTCACTCACAAAACAACTTTGTGTCGCTTGTTTTTATATAGCACCAGAGAAAGGCCCTACTGTCACAGATACCATTTCCAAGAAAAATAGTGTTACACTGATATGGGAGGAAATTCCACTGGACCACCGGTATGGATTCATCCAAAACTACACCATATTCTACAGGACCGGCAACGCTGAGTGGCAATGTATGCTTGACATATGAGAATTTTGCAATGTTTGAATGATTTCACAAGCAGCTACAAATTATCTAATGTTTCTCACTTGTTTTTTGGCAGCTGTGCTAGTGGCCGCTAACATCCACTCGTATGTATTGACTGATCTGGTCAGTGAACGCGACTATGTGGTTCACATCATGGCCTCGACGGA
Associated Phenotype:
Not determined