Busch Lab

ZMP

grin2bb

Ensembl ID:
ENSDARG00000030376
ZFIN ID:
ZDB-GENE-061207-27
Description:
glutamate [Source:RefSeq peptide;Acc:NP_001121809]
Human Orthologue:
GRIN2B
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Mouse Orthologue:
Grin2b
Mouse Description:
glutamate receptor, ionotropic, NMDA2B (epsilon 2) Gene [Source:MGI Symbol;Acc:MGI:95821]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12697 Nonsense Available for shipment Available now
sa19556 Nonsense Available for shipment Available now
sa18703 Nonsense Mutation detected in F1 DNA Not yet available
sa9856 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12697
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 555 1770 9 16
ENSDART00000143664 Nonsense 555 1770 8 15
Genomic Location (Zv9):
Chromosome 1 (position 45877619)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44715131
GRCz11 1 45406926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGTATAGACATCCTCAAGAAKATCGCCAAGTCTGTCAAATTCACCTA[C/A]GATCTCTACTTGGTGACCAATGGGAARCACGGCAAGAAGATCAACGGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7913
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1082 1770 16 16
ENSDART00000143664 Nonsense 1082 1770 15 15
Genomic Location (Zv9):
Chromosome 1 (position 45849231)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44686743
GRCz11 1 45378538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATCATTACCTACACCACCATGGGGGATCTGAACTGGCTCTYGGTATGT[C/A]GGGTCCCCTGCCTAAYCGACCTCGTAGCTTAGGGAGTGCCAGCTCATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19556
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1097 1770 16 16
ENSDART00000143664 Nonsense 1097 1770 15 15
Genomic Location (Zv9):
Chromosome 1 (position 45849186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44686698
GRCz11 1 45378493
KASP Assay ID:
2259-0966.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTCGGGTCCCCTGCCTAACCGACCTCGTAGCTTAGGGAGTGCCAGCT[C/A]ATTGGAGGGTGGGTACGATTGTGACAGTTTAGGGGGAGGGGTAGCGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18703
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
Genomic Location (Zv9):
Chromosome 1 (position 45848953)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44686465
GRCz11 1 45378260
KASP Assay ID:
2259-0965.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGGCATCCAGTTCAGGGTTTATTGCAGGACATGACAGGTACTGCGGG[G/T]GAGGTGGGGTGGGATCGGGAGGGGACGATGGAAACATTCGATCCGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
Genomic Location (Zv9):
Chromosome 1 (position 45848953)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44686465
GRCz11 1 45378260
KASP Assay ID:
2259-0965.1 (used for ordering genotyping assays)
KASP Sequence:
GTGRGGCATCCAGTTCAGGGTTTATTGCAGGACATGACAGGTACTGCGGG[G/T]GAGGTGGGGTGGGATCGGGAGGGGACGATGGAAACATTCGATCSGACGTG
Associated Phenotype:
Not determined