Busch Lab

ZMP

gtf3aa

Ensembl ID:
ENSDARG00000030267
ZFIN ID:
ZDB-GENE-041006-1
Description:
transcription factor IIIA [Source:RefSeq peptide;Acc:NP_001003866]
Human Orthologue:
GTF3A
Human Description:
general transcription factor IIIA [Source:HGNC Symbol;Acc:4662]
Mouse Orthologue:
Gtf3a
Mouse Description:
general transcription factor III A Gene [Source:MGI Symbol;Acc:MGI:1913846]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26628 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26628
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049331 Nonsense 35 367 1 9
ENSDART00000129565 Nonsense 33 365 1 9

The following transcripts of ENSDARG00000030267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70975986)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67315165
GRCz11 5 67992876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCCTATCCGGAATGTCACGCGTATTACAACCGAGAGTGGAAGCTA[C/T]AAGCGCATCTCTGCAAACACACCGGAGAGGTCAGTTAACACACACACATG
Associated Phenotype:
Not determined