Busch Lab

ZMP

TRAF2 (2 of 2)

Ensembl ID:
ENSDARG00000030173
Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Human Orthologue:
TRAF2
Human Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Mouse Orthologue:
Traf2
Mouse Description:
TNF receptor-associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:101835]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40445 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40444 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40445
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043466 Essential Splice Site 201 502 5 11
Genomic Location (Zv9):
Chromosome 5 (position 30400095)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28161884
GRCz11 5 28762037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAATGATTTGTGAAGGCTGTGCCAAGAAAAAAATTCCCAGAGAGAAAG[T/A]AAGTAAATGCTATTTAGGCCATTTACATGTATCAATGTTATGTCACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40444
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043466 Nonsense 357 502 9 11
Genomic Location (Zv9):
Chromosome 5 (position 30396607)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28158396
GRCz11 5 28758549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAAGATGAGGGAGATGTCTGCTGCCACCTATGATGGTGTGTTTGTATG[G/A]AAGATCTCAGACTTCTCGAAGAAGAGACAGGATGCTGTAGCTGGACGAGC
Associated Phenotype:
Not determined