Busch Lab

ZMP

LOC569515

Ensembl ID:
ENSDARG00000030163
Human Orthologues:
CDK4, CDK6
Human Descriptions:
cyclin-dependent kinase 4 [Source:HGNC Symbol;Acc:1773]
cyclin-dependent kinase 6 [Source:HGNC Symbol;Acc:1777]
Mouse Orthologues:
Cdk4, Cdk6
Mouse Descriptions:
cyclin-dependent kinase 4 Gene [Source:MGI Symbol;Acc:MGI:88357]
cyclin-dependent kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1277162]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40125 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25258 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40125
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049720 Essential Splice Site 178 305 4 7
Genomic Location (Zv9):
Chromosome 3 (position 39173586)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39036946
GRCz11 3 39178804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGTAGTGAGATCTTGCATGCAACGTATTTGTATGTTGTGTTTGTGTGT[A/G]GGTTGTGACTTTGTGGTACAGAGCTCCAGAAGTCCTGCTGCAGTCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049720 Essential Splice Site 231 305 5 7
Genomic Location (Zv9):
Chromosome 3 (position 39172803)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39036163
GRCz11 3 39178021
KASP Assay ID:
554-7827.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTGTTTCGTGGCTTCACAGAGATCCAACAGCTGCAAAAGATCTTTGA[G/T]TGAGTCAAAAAGCTTATGTGTGGTTAATGTTGACTGGATTAATTTAAATT
Associated Phenotype:
Not determined