Busch Lab

ZMP

mybpc2a

Ensembl ID:
ENSDARG00000030157
ZFIN ID:
ZDB-GENE-060901-1
Description:
hypothetical protein LOC751793 [Source:RefSeq peptide;Acc:NP_001039324]
Human Orthologue:
MYBPC2
Human Description:
myosin binding protein C, fast type [Source:HGNC Symbol;Acc:7550]
Mouse Orthologue:
Mybpc2
Mouse Description:
myosin binding protein C, fast-type Gene [Source:MGI Symbol;Acc:MGI:1336170]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20031 Essential Splice Site Available for shipment Available now
sa31336 Nonsense Available for shipment Available now
sa10086 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Essential Splice Site 111 822 8 26
ENSDART00000103461 Essential Splice Site 100 1120 6 29
ENSDART00000121883 Essential Splice Site 100 1120 6 29
Genomic Location (Zv9):
Chromosome 3 (position 30442661)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30160700
GRCz11 3 30291542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGACTTGTTCTCTAGAGCTGAGAGTTACCATTTATATTTCTCTGTCGC[A/G]GATTTACACCTATGAGATGACCATCGTTAAGGTCGTGGATGGAGATGCTG
Long Flanking Sequence:
CCCTTCAATCCCTATGGATGTTTCCCAGTATTGGTAAACATCCATAGACTCTCACATTTACAAACGCACTCATACACTATGGACAATTTAGTTTATTCTATTTACTTACACCGCATGTCTTTGGACTGTGTGGGAAACCGAAGTACCCAGAGGAAACCCATACAAACATGTGGAGAACATGCAAATGCCACACAGAATTGCCAACTGACCCACAAGACCCAGCCAGTAATAATTATTTAGTTTAGCATTATTTAATTTTTATTTTGGTTTATAGGGAAGGATGTCACATTTGTGGCTAAGGTGGACTCCTCTCAGATGTTAAGAAAGCCAGCCGTTAAGTGGTTTAAGGGGAAATGGCTGGATCTGGCCAGCAAGGCTGGAAAACACTTGCAGTTCAAAGAAACCTATGACAGGAACACAAAGGTGAGTAAAGGAAAGTTGTCCTCGATTAGGGACTTGTTCTCTAGAGCTGAGAGTTACCATTTATATTTCTCTGTCGC[A/G]GATTTACACCTATGAGATGACCATCGTTAAGGTCGTGGATGGAGATGCTGGAGGTTATCGCTGTGAGGTCACGTCCAAAGACAAGTGTGACACCAGCGCATTTGATGTTACTGTCGAAGGTAAGAATTCAGGCAGTTATAAAGTGGCTCAACATTGAAGTTATCAGTGCCAGCTTGAGATCCCTGATGCATAGGACATTTAAAATGCACAAAATGTAGCCTTAGATGTCTAAAGTTAACACGCATCTGGCGTGCGTGCGCACTTTGCTGCAATCTACAGCTGATTCATTATTCAGTAGGTATTTAGCTGATTAGATCGTCTGCCGCACTTAGTAAATCAGCACTACACATTTATTGGCTTTGACAGTAATCAGATTGTGGAGCAAATCAAACACTCACAGTTTCTCATCATCATCACGCATTTCATCTTCTCCTTCAGCTGCTGAGGAGACACAGCAAACAAACATTTTGGAGGCGTTCAAGCGATCGTAAGTTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8124
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Nonsense 155 822 9 26
ENSDART00000103461 Nonsense 144 1120 7 29
ENSDART00000121883 Nonsense 144 1120 7 29
Genomic Location (Zv9):
Chromosome 3 (position 30443114)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30161153
GRCz11 3 30291995
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCATCATCATCACGCATTTCATCTTCTCCTTCAGCTGCTGAGGAGACA[C/T]AGCAAACAAACATTTTGGAGGCGTTCAAGCGATCGTAAGTTTGTTTGTGT
Long Flanking Sequence:
GACTTGTTCTCTAGAGCTGAGAGTTACCATTTATATTTCTCTGTCGCAGATTTACACCTATGAGATGACCATCGTTAAGGTCGTGGATGGAGATGCTGGAGGTTATCGCTGTGAGGTCACGTCCAAAGACAAGTGTGACACCAGCGCATTTGATGTTACTGTCGAAGGTAAGAATTCAGGCAGTTATAAAGTGGCTCAACATTGAAGTTATCAGTGCCAGCTTGAGATCCCTGATGCATAGGACATTTAAAATGCACAAAATGTAGCCTTAGATGTCTAAAGTTAACACGCATCTGGCGTGCGTGCGCACTTTGCTGCAATCTACAGCTGATTCATTATTCAGTAGGTATTTAGCTGATTAGATCGTCTGCCGCACTTAGTAAATCAGCACTACACATTTATTGGCTTTGACAGTAATCAGATTGTGGAGCAAATCAAACACTCACAGTTTCTCATCATCATCACGCATTTCATCTTCTCCTTCAGCTGCTGAGGAGACA[C/T]AGCAAACAAACATTTTGGAGGCGTTCAAGCGATCGTAAGTTTGTTTGTGTGCTTCTGTCTTTCTCATTAGTGTCTGGTGGATGTCTTCATGTCACATTGTTTTAATGAACTGTTCAGATGCTTTTCATTGTTTAAAGGGATTTTTCATTTGATATCTTCATATTGCCACTGACACTTCATGTTTAGATGTTGCTGTAAGTGTACACAGATTTAGCGACTAATGCTTCTCATCTTTATACATTAATGATAACATGATACTCTTGTATATCGTTGAGGGAGCCGTCTGTTGCCAGAAGCTGCTCTTCTGACCAGTTATAATCTTATGGACTGATTGAGTAGGGGTTTTCCCTCATGTCTGAGAGTTCAGCTTCAAGTCCAGCTCTTGACAGTAGAGATTTAGTCATAGGACTGAGCCAGGCTCCAATTGTTTAAGTAGAACATAGTGCTACTTTAATGCTAAGTCAAAGGTTTAATCACCAGTGGAATGCATCCGGCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31336
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Nonsense 365 822 15 26
ENSDART00000103461 Nonsense 369 1120 13 29
ENSDART00000121883 Nonsense 369 1120 13 29
Genomic Location (Zv9):
Chromosome 3 (position 30453969)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30172008
GRCz11 3 30302850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGATGAAGGATGGTGTGGAACTGAGCCGAGATGGAAAGTATCGCTTT[A/T]AGAAAGATGGGACAAAGCACTGGCTCATCATCAATGAAGCAACCACAGAG
Long Flanking Sequence:
CTGATGAGTGTGTATAGGTGTTTCCCTGTACTGGGTTGCAGCTTGAAGGGCATCCGCTGCATCAAACATATTTTGGGATAGTTGGAGGTTGATTTCGTTGTGGCGACCCCTAATAAATAAGGTACTAAGCTGAAGGAAAATGAATGAATGAATTATTTTGTCTCCAGTAGAATCCAGCCTCTTAAGTATCTTAAGGATCCTAGTTTAGTTCTAAACTGATCCATCCCTAAAGTGTTTTCCTGTATCAAAGACCTGCACAGACTTTCCTCTCTCTGGCTTTGCCTCTTTCTGTCATGTCCCATTTTGTCCATCCTTGTTCCCTTTCTACGGGTCCCAGTCATTCTTTTATCTTCCTTCATCTTGGAGTAGATTGCCTTCCTCAGTTTCTTCTTATGAACATTTTTTCCAACTTAGTCTCTCTCTGTCTCGCTCTCCCTCTCTTCATCTCTCTCAGGATGAAGGATGGTGTGGAACTGAGCCGAGATGGAAAGTATCGCTTT[A/T]AGAAAGATGGGACAAAGCACTGGCTCATCATCAATGAAGCAACCACAGAGGACATCGGGACATACTATGTGTACACCAGCGGAGGGGAGTCCAAGGCAGAGCTTGAAGTGGAAGGTACTTCTTTCAAAAGAATAAAGTGACAGCTCTCCCTTCTGCCAGTTGGCCGATATTTCAGTATTATTTCTGTGCTTATTTTTAGAATCAGTTGCCTCATTGTCCTTTTGTTTTGTTCTATAGAGAGAGAACTGGAAGTTTTGCAAAGTATAGCTGATCTGACAGTGAAGGCAGCAGAACAGGCCGTCTTCAAATGTGAAGTTTCTGATGAGAAAGTGACTGGCAAGTGGTTCAAGGATGGGGTTGAGGTTGTCGCCAGTGACCGCATCAAAATGTCACACATTGGCAGGTATATCAATCCGCTTGCTTATCGATTGATGCATAAGCAAGCTCACTTCATCCTTGACCTCGCGAATATTGTTTTATACCAGGACCCTAAAACCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10086
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103457 Nonsense 438 822 16 26
ENSDART00000103461 Nonsense 442 1120 14 29
ENSDART00000121883 Nonsense 442 1120 14 29
Genomic Location (Zv9):
Chromosome 3 (position 30454313)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30172352
GRCz11 3 30303194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCCGTCTTCAAATGTGAAGTTTCTGATGAGAAAGTGACTGGCAAGTG[G/A]TTCAAGGATGGGGTTGAGGTTGTCGCCAGTGACCGCATCAAAATGTCACA
Long Flanking Sequence:
TTTATCTTCCTTCATCTTGGAGTAGATTGCCTTCCTCAGTTTCTTCTTATGAACATTTTTTCCAACTTAGTCTCTCTCTGTCTCGCTCTCCCTCTCTTCATCTCTCTCAGGATGAAGGATGGTGTGGAACTGAGCCGAGATGGAAAGTATCGCTTTAAGAAAGATGGGACAAAGCACTGGCTCATCATCAATGAAGCAACCACAGAGGACATCGGGACATACTATGTGTACACCAGCGGAGGGGAGTCCAAGGCAGAGCTTGAAGTGGAAGGTACTTCTTTCAAAAGAATAAAGTGACAGCTCTCCCTTCTGCCAGTTGGCCGATATTTCAGTATTATTTCTGTGCTTATTTTTAGAATCAGTTGCCTCATTGTCCTTTTGTTTTGTTCTATAGAGAGAGAACTGGAAGTTTTGCAAAGTATAGCTGATCTGACAGTGAAGGCAGCAGAACAGGCCGTCTTCAAATGTGAAGTTTCTGATGAGAAAGTGACTGGCAAGTG[G/A]TTCAAGGATGGGGTTGAGGTTGTCGCCAGTGACCGCATCAAAATGTCACACATTGGCAGGTATATCAATCCGCTTGCTTATCGATTGATGCATAAGCAAGCTCACTTCATCCTTGACCTCGCGAATATTGTTTTATACCAGGACCCTAAAACCGATTAGTCATCAAAAATGTCAGCTATGCTCTTTTGTTTTCTTTCAGTAACATTTATTGATTTTTCTTGGCTACACTTCTTGTATTGTGGTAACATTAGATCTCACTCACCAAGCATGTGTATGAAAAATTAAACTATACAAATTTAAATTGGAACAGCCAAAACCACATGTGTTGGGGTGCTTAAAGGAATGGCTGAGAAGAAAGCCTTAATATGGAAATGGTTTAGGGCGTCTTTTATGCAAACAGACAATTTTGTGCAGATGGCCACTCATTTACAATACTTCAAATTCATTATTAAACAGAAACAAGCATGCTAGTGTTGTGCATACACATGTTAAGCAAAGAA
Associated Phenotype:
Not determined