Busch Lab

ZMP

PAK7 (2 of 2)

Ensembl ID:
ENSDARG00000030154
Description:
p21 protein (Cdc42/Rac)-activated kinase 7 [Source:HGNC Symbol;Acc:15916]
Human Orthologue:
PAK7
Human Description:
p21 protein (Cdc42/Rac)-activated kinase 7 [Source:HGNC Symbol;Acc:15916]
Mouse Orthologue:
Pak7
Mouse Description:
p21 protein (Cdc42/Rac)-activated kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1920334]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23829 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23829
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042607 Essential Splice Site 111 206 3 4
Genomic Location (Zv9):
Chromosome 20 (position 55029712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54908289
GRCz11 20 54738653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCTGTGACTTCTGACCTGTGCTGGTGAGTCTGACCAGTCTGTGTGTGC[A/T]GGTGGACATCTGGTCTCTGGGCATCATGGTGATAGAGATGGTGGATGGAG
Associated Phenotype:
Not determined