Busch Lab

ZMP

gnptab

Ensembl ID:
ENSDARG00000030153
ZFIN ID:
ZDB-GENE-030131-4714
Description:
N-acetylglucosamine-1-phosphotransferase subunits alpha/betaN-acetylglucosamine-1-phosphotransferase
Human Orthologue:
GNPTAB
Human Description:
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits [Source:HGNC Symbol;Acc:29670]
Mouse Orthologue:
Gnptab
Mouse Description:
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40269 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5257
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040445 Essential Splice Site 433 1222 10 21
ENSDART00000048782 None None 106 None 8
ENSDART00000101154 Essential Splice Site None 327 11 14
ENSDART00000113990 None None 139 None 8
ENSDART00000121714 Essential Splice Site 433 1219 10 21
ENSDART00000132309 None None 106 None 3
Genomic Location (Zv9):
Chromosome 4 (position 16754248)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17697088
GRCz11 4 17686064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAGGATGTGTGGCCTGATGACTTCTATAGCCACTCCAAAGGCCAAAAG[G/A]TCAGAAACTCTTTCACTGCATCTGAACAAYTTGAATCTTTATTYTAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40269
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040445 Nonsense 855 1222 13 21
ENSDART00000048782 None None 106 None 8
ENSDART00000101154 None None 327 None 14
ENSDART00000113990 None None 139 None 8
ENSDART00000121714 Nonsense 852 1219 13 21
ENSDART00000132309 None None 106 None 3
Genomic Location (Zv9):
Chromosome 4 (position 16757806)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17700646
GRCz11 4 17689622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCGCGAGCGGCCAACTGGTCGTAGGCTTCAGTTTTACAGCGACAGCT[T/A]GAACAGAGGTTTCCTGCCGTGGGAGAAGAGGAAGTTCTTTCAGGATCTGA
Associated Phenotype:
Not determined