Busch Lab

ZMP

nup188

Ensembl ID:
ENSDARG00000030022
ZFIN ID:
ZDB-GENE-030131-7184
Human Orthologues:
NUP188, RP11-101E3.5
Human Description:
nucleoporin 188kDa [Source:HGNC Symbol;Acc:17859]
Mouse Orthologue:
Nup188
Mouse Description:
nucleoporin 188 Gene [Source:MGI Symbol;Acc:MGI:2446190]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9709 Essential Splice Site Available for shipment Available now
sa43571 Nonsense Mutation detected in F1 DNA Not yet available
sa37216 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Essential Splice Site 153 1732 7 44
Genomic Location (Zv9):
Chromosome 21 (position 4810006)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4387418
GRCz11 21 4551983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTCTTCACCTCCTCACYTACTTCCAGGATGAGAGACATCCATAYAGGG[T/A]AATAATAATGACAGATCAGATTTATTATYGGCWGAGTTTGTTATTWTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43571
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Nonsense 541 1732 16 44
Genomic Location (Zv9):
Chromosome 21 (position 4826507)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4403919
GRCz11 21 4568484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTCTGTGGGTGAACAGGGTTTCCTGGTGCGCTGGGAATATTCCTA[C/A]AGCTCCTGGACTCTTTTCACCTGTGAGATCGAGATGCTGCTGCACGTCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4146
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Nonsense 1217 1732 33 44
Genomic Location (Zv9):
Chromosome 21 (position 4847907)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4425319
GRCz11 21 4589884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGGACCGAACCAAAGCCAAACTCCTGTCAGGCCTCATCCTCGCCTTG[C/T]AGATTCAGGGACTCAATGGTCAGTACATTCAATTCATCTTTATTTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37216
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043431 Nonsense 1441 1732 38 44
Genomic Location (Zv9):
Chromosome 21 (position 4853681)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4431093
GRCz11 21 4595658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTATGTGCAGTGTCTGAATGCGGTACGGACGGTTCAGTCTCTGGCGTG[T/A]CTGGATGAAGCTGATCACACCGTGGGTTTTCTGCTCCAGCTCTCCAACTT
Associated Phenotype:
Not determined