Busch Lab

ZMP

agfg1a

Ensembl ID:
ENSDARG00000030020
ZFIN ID:
ZDB-GENE-030131-5808
Description:
arf-GAP domain and FG repeats-containing protein 1 [Source:RefSeq peptide;Acc:NP_956129]
Human Orthologue:
AGFG1
Human Description:
ArfGAP with FG repeats 1 [Source:HGNC Symbol;Acc:5175]
Mouse Orthologue:
Agfg1
Mouse Description:
ArfGAP with FG repeats 1 Gene [Source:MGI Symbol;Acc:MGI:1333754]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35962 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4620
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043960 Nonsense 272 556 6 13
ENSDART00000124780 Nonsense 490 774 9 16
ENSDART00000144944 None None 225 6 7
Genomic Location (Zv9):
Chromosome 15 (position 34468458)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35314234
GRCz11 15 35172203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCACAGCAGCATTTCCATCAGCTCCACAGGCTCCATTTCAGCCCCCA[C/T]AACCAGGTAGACCACACACACACACACACACACACACACACACACACACA
Long Flanking Sequence:
TGAGACTATTATTACCAAGCCTGCCTTCTCTGTTCTTTACTGCTGGAGTTGATGCAGGTGCATTCTGGTTAGAGGTGCACCCCCCCTCTGTTTTGTCTTCATTTAGATTATGTGTGTTGTGTTTTTGAATATTAGTTTAGTTCAGCATTGTAATCACTTTTTATCATCATGTCTTTACACACAACCAGCGTGTAAGTTATGGTTCTTTTTTTAGACGATTAGCTAAATAAAAATCATTTATTTTTTAAACTGAAATGTGAGATTATCAGGACATTTCTGACGAAAAAACTTAAACGCTGGATGTTCATCCTGTAGTTTTCATCCCTCATTTCATTTTCTGTTGTGTTTTGTTTGTTTTGTCTGTTTGTTTTTGGTGGTACCCAACAGCGCAGAGCGTGAATGCTAGCGCAGACTTTGCGAATTTTGATACGTTCAAAAGTTCTGCTGCTCCAACCACAGCAGCATTTCCATCAGCTCCACAGGCTCCATTTCAGCCCCCA[C/T]AACCAGGTAGACCACACACACACACACACACACACACACACACACACACACACACAGCTAAACAAATGACCACACATTTACCTTGAACCTCTCATCGAGAAATGGCTCTTGGTTGAAGTTGTATTTCTTCGAAGTCTGTCGTTCTTTTTGTGTGTATTTTCAGTGCTGATTGTTTACATTCTTGCCTCTAAACTATTTCATCTTTTTATCAGTGTGTTGTAATTTTACGTTTTAATCCTTCTTTTAAAAAAAACAAGTCTTGCTAACACATCTGTTTGATTTTATTATTCAGTCATTTCATTTCTTCACTGATAGCTTGGCTTTTCCTTTCTTTTTTTTTATTTCTTTTTTTGATTGTGTCATTTATTTCTTCATTTTTACAGGGTCCCCACGCTTCTTGAAAGTACTTAAAAGTACTTGACATTTTTCTTCCACTGTAAAGACACTTGAGTTTCTTTTTGTACATGATATAACTGGAAACTTCTACCAGAAACGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043960 Essential Splice Site 395 556 8 13
ENSDART00000124780 Essential Splice Site 613 774 11 16
ENSDART00000144944 None None 225 None 7
Genomic Location (Zv9):
Chromosome 15 (position 34459857)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35305633
GRCz11 15 35163602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGTGCCAAATGTGAGCGGCTACCAAGCGGCCACTACAGCACAAGG[G/A]TGAGAATGTAAAGTCAAGATTTTCTGTTTTTCTCTCAACACCTTTTACTA
Long Flanking Sequence:
TTTAGTCATTTAGCAGATGCTTTTGTCCAAAGAGTCTTACAATTGAGGAGGCATTCAGCGATTCAACACAGAGCCAATACACACAAGAAGTGCCAATCATACAAAGGAACTGTTAGTGCTCAGAGAATTAAATGGTAGTGTTTTGTTTTTTTTTGTTTTGTTTATTTGAGAAGGGCGTGAAGAGTGTTTCCACAGGTGGTTTTGTCAAGCCCACTTACCCATGTTTAGCTCACTTTAAAAATGCATAGTGATTTTTATTTATTTTTTATTTTTTTGTATTTATTCATTTTTTCACAAATAATAGCTGAAAATAAGTCCTGTTCTGTCTGTCTGTCCACAGGTCCAAGTTCAGCTCCTCCGTCAGCAGGTGTGGGTCCTCCACCTCCACAGGCCGCTCTGTTGGGTGGTGATCGCTACGCTGCTTTCGCTGAACTGGACAATGTCTTCGGGCCCTCAGTGCCAAATGTGAGCGGCTACCAAGCGGCCACTACAGCACAAGG[G/A]TGAGAATGTAAAGTCAAGATTTTCTGTTTTTCTCTCAACACCTTTTACTATGTCACGTTAAACTCTTGTTGGTTTCAGGGCTGTTTATGGAACCTCTTCAGCTGTTCCTACTGCTCAAGCACAACAGGGTTTACCCAACATCCCTCAGGGTTTTGCAGGTAAACCTCTGTCTTTTTTTTTTTTTTTTTGTAGATATACATTTAGTTGCTTTTAACAAGAATAACACTATAACAGACACACAAATGCATTTATATACATACCATCGCCAAGAAAAGAAACTGCATACAAATTTAATTTTGTGATATTTTTCAAATGATGTTTAACAGGGCAAGGACATTTTTCACAGAATTTCCTTTTTTTTCTGCTGGAAAAAGTCGGCTAGAAAAAAAAGCAGCTTTAATTTAAAAAATATATTGTAAGGTTTATATTATTAGCCTCCTTAAGTAAGACAACTAAGAAATAAATGTTCAATATTTATAAAATGGTTCAAGAGGAATTGT
Associated Phenotype:
Not determined